PCR primers used in Hanslik et al. (2000)

LOCUS Forward primer (5'-3') Reverse primer (5'-3') Annealing temperature (°C) Internal reference
AGLA13 gctcgaattcttactcttctgtttc ccagcaccatggaaattctcagtc 56 576/574
AGLA226 ctaaagaaatgcagtgttgtcagcc cttaacaagccatgctgaatggtct 58 371/372
AGLA233 tgcaaacatccacgtagcataaata gcatgaacagccaatagtgtcatc 58 373/374
BM1329 ttgtttaggcaagtccaaagtc aacaccgcagcttcatcc 58 379/380
BM3413 tccctggtaaccaatgaattc caatggatttgaccctccc 58 463/464
BM2113 gctgccttctaccaaataccc cttcctgagagaagcaacacc 61
BMS712 atatgaagggcccagaggac acggtcactgagtatggaggc 60 458/477
BMS817 tgggaaagttggcaaatg ttgtgatacctgaaatggtcaa 58 465/466
BMS829 ccttcacctagtcctaccaagg ctggcaagctacagtccatg 60 473/474
BMS2842 gaaactgcctgcaaaagtaatc aactggttttcagaaggagaca 58 478/479
BMS2508 tttctgggattacaaaatgctc tttcttaggggagtgttgattc 56 471/472
BMC4216 tgagggaaaagggagatgg gagtggttcacaaaaatgtgc 54 381/382
BMC1013 aaaaatgatgccaaccaaatt taggtagtgttccttatttctctgg 54 377/378
BP36 aagcctaactcctgggaacc tacaatgggatgttattcagcc 50 571/572
ETH10 gttcaggactggccctgctaaca cctccagcccactttctcttctc 61
ETH3 gaacctgcctctcctgcattgg actctgcctgtggccaagtagg 61
ETH225 gatcaccttgccactatttcct acatgacagccagctgctact 61
HUJ175 ctgaagttatcctggaaggg aacaagaatggctggtcacc 58 389/390
ILSTS087 agcagacatgatgactcagc ctgcctcttttcttgagagc 58 383/384
ILSTS090 tagtaccatacccaggtagg gccaaaacacacaagtgtgc 58 469/470
ILSTS095 gaaagatgttgctagtgggg attctcctgtgaacctctcc 58 461/462
ILSTS013 cttgatccttatagaactgg acacaaaatcagatcagtgg 58 467/468
INRA23 gagtagagctacaagataaacttc taactacagggtgttagatgaact 61
OREL03 gcttccttggaaaggaaagcagtc agacaagttctgcagataccctgc 58 911/912
RM178 cctggaaaatcccatgaacagag ggaaaagaagggataagtaggcag 60 459/460
SPS115 aaagtgacacaacagcttctccag aacgagtgtcctagtttggctgtg 61
TGLA10 ctaaatttatcccactgtggctctt caatctgcagtagcatacatccttg 58 387/388
TEXAN5 tggaaataccgactcctgattc catggtctaacatctaataaatgcc 58 475/476
TGLA122 ccctcctccaggtaaatcagc aatcacatggcaaataagtacatac 61
TGLA126 ctaatttagaatgagagaggcttct ttggtctctattctctgaatattcc 61
284 gggtttaaaagaaaatcaaacacc aaggttcagtgcagccaaat 56 898/899
2158A1 tggagggtaaaaggaagtcag gtttcactcagctgctcaaggaca 56 495/496
2158A2 gtacccctgctaggtgcaaa acttcccacccctgttcc 56 789/790
105A2 acgttgcagattgagcc cttccactacccaccaca 56 515/516
105S1 ttgctaatatcaggagaatacgc tgcccttgtttacacttagca 56 902/903
105D4C3 aagttgttttgttgtggggg aaaacatgattctgtatcaataaagtg 56 586/587
108B9G3 ctgctcatcttccgactcct gcgcaggaagcagagaaac 56 603/604
108B9A1 tcccctctgccttgtgttag gtttcctttctctatctcctttatacttcaa 56 503/504