D. melanogaster microsatellites located on the 3rd-chromosome


        D. melanogaster       D.simulans       D.sechellia       D. mauritiana            
Locus Repeat cyt. location No. alleles Het. Variance Size range No. alleles Het. Variance Size range No. alleles Het. Variance Size range No. alleles Het. Variance Size range Annealing temp. Primer forward reverse internal reference
3R4260596gt GT10 85A 4 0.53 2.60 102-108                         51.0 ATGTGTTTCGCATTCGTG GCTTGAGTGTTTCTGTGTTG 1922/1923
3L10044806ca CA11 67d 9 0.78 82.49 76-114                         50.4 GATAACCACACACTCGCAC GCTCGGCTGTCAGAATTTTG 1733/1734
3L10133556gt GT11 67d 4 0.40 1.47 116-126                         53.5 ACCCTCACCTGCCGCTAC TCGTCCTGGAAATGCCTC 1731/1732
3L1127648gt (GT)11 61F 7 0.46 2.05 117-131                         51.1 CATTTCTAAGGACCTGCTG CGACAACTGAACAACCATAAC 1407/1408
3L12139804gt (GT)12 68F 4 0.67 1.01 125-137                         52.5 ACATTTCCTCAAACATCCGAC AAACGCTAAGGCAAACAG 1603/1604
3L13408501ca (GT)13 70B 6 0.70 2.61 119-175                         53.7 TCTATTGTCGGTGTGGCTC GTTCCACCACGGCTTGTCG 1579/1580
3L13844712ga (GA)13 70C 3 0.42 0.53 114-132                         50.7 ACAGAGACAGCAATAGTGGAAC TAAAGCATTTCTACTTCTACTG 1585/1586
3L14197261ta (TA)11 70D 6 0.65 1.78 148-178                         51.1 AATCGCAAGACAATGGGAC CCTTGAGCAACCAGCAAC 1587/1588
3L1464732ga (GA)12 62A 10 0.44 1.43 123-141                         52.8 GGCAAAGATATGAATGGCTC GGCGAGGACATTATTAGGTC 1409/1410
3L15290185ca (GT)13 71B 4 0.45 0.57 129-155                         53.3 AATAATACGCCTGACACTCGCAC TTTCCTCCCCTCTTTGGTATC 1575/1576
3L15443860ca (GT)11 71C 4 0.53 2.10 118-140                         49.6 GAGGTTCGTTGAACTCATC AGAATCAGCAAGCAGTATGG 1577/1578
3L16575599gt (GT)12 73C 6 0.70 2.13 153-253                         48.2 TTAGGTGATTTCTTTCCACTC TCGTTTTTCTATGGCAAGTC 1567/1568
3L17067764gt (GT)18 74D 9 0.75 9.20 72-98                         52.7 TCAAAGTTCACATCAAGGTGTTG ACGCAAACCCAAAAGGCAC 1571/1572
3L17166925ca (GT)13 74C 5 0.66 1.10 84-108                         55.9 CAAGTTGAACGCCCACACAAGC TGTCCTGCTCCTCCTGTTCGTC 1569/1570
3L17555891ct (GA)13 74F 9 0.81 4.59 116-142                         50.9 TCTTGCTGTGTGGCTTATTAG GCTGCTCGTAATTCCAAAATC 1561/1562
3L18033782ga (GA)12 75C 10 0.80 14.50 121-161                         53.7 GCAGTAGCGAACATAATATAGTTG GAAAGACCAGTAAGTGAAAGTGAG 1563/1564
3L18673367ga (GA)18 75D 11 0.81 6.51 100-112                         53.9 ATAGAGGCGTGTGAGCGAGAG TTACCAAACCAACCAAGAGTC 1556/1557
3L19131867ta (TA)14 76B 5 0.58 2.04 131-149                         49.4 ACAAACTTGGGGCGGGCATTC AGTTGATGTTCTTGCGGTT 1559/1560
3L19781432ct (GA)15 76E 9 0.81 4.07 140-158                         53.8 TTCCCTGACTTATCCCCACAC AGAACAATCTGACCGAACTGA 1537/1538
3L19955587ca CA9 76f 3 0.13 1.53 102-108                         55.0 GGGAGTGGGAACTTTGTG GCTGATTGTCGTTGTGGTC 1968/1969
3L20028475ca (GT)13 77A 3 0.22 0.77 54-84                         48.6 GAGAACGAGGACCCAAAACTG CAAAGGAGGCATTGTTATGA 1539/1540
3L2007563ca (CA)14 62D 6 0.54 7.45 139-157                         56.3 GCCCCTCGTCCATTAGCAG CATTTACCCACCCGCCCAC 1411/1412
3L21099506ca (GT)14 78C 7 0.75 9.51 70-104                         52.5 TAAATGGAGTCAAATGCCAAC GGTGAGTATCTGTGTGAGTGC 1543/1544
3L21309672gt (GT)13 78D 5 0.57 0.81 66-92                         54.1 CTGCGAGTTTCCCTGCCTGTG GTTTGCTTAGCGATAAGGACG 1589/1590
3L21961365ca (GT)13 79C 6 0.76 16.02 94-142                         52.9 CTTTATCTAATGCCAGACGAC CCACCCCTTCCGAAACTCCAG 1547/1548
3L22168867caa (CAA)11 79D 10 0.80 17.21 94-170                         51.1 ATAAATAACCGTGTGAGGCTG CTCCTGTTGCTGTGTTTGTTC 1554/1555
3L22184535ga (GA)11 79D 3 0.26 0.14 151-155                         57.6 TGTCGTAATGCCAGCCAAGGT GTTGAGGGGTTGCGAGAGGAG 1552/1553
3L22333141gt (GT)12 79E 7 0.78 6.75 66-88                         50.3 CACTTCAAGCAGCCACTGTTCCT AAATTACCGACACATAGACCA 1550/1551
3L2299865gt GT10 62d 5 0.28 1.01 114-124                         55.0 CTTGACATCATTGCGGGTGC GAATACCACCCTTCCAATCAC 1653/1654
3L2674504gt (GT)14 63A 6 0.39 1.42 135-145                         54.4 TGTAGGCAACATTCAACGAG CAACGCACAGCATCCACATCC 1413/1414
3L3926408gt GT12 64a 7 0.47 9.65 116-130                         54.3 GCAGGAGGCATGTGGAAC ATGGGCAGGTCTGAAATG 1954/1955
3L500820gt (GT)12 61C 6 0.71 7.91 136-168                         55,2 TCTCCTGGCGACTCACTTAG CGAAACAAACGACGGCAG 1403/1404
3L5235154gt GT13 64d 5 0.44 5.90 174-186                         55.7 TCCTCCTGCTCAACCATTTC TTTAACGATGTCTTGGCGAC 1946/1947
3L5755965gt GT12 64f 5 0.58 7.73 130-140                         47.7 CGAAATTAAGTAGCTCCA GCAAGCCCTTCTTTAACC 1940/1941
3L5797984ca CA13 64f 6 0.71 6.73 161-171                         54.1 GCGTTAATCAGATCGTTTACAC CGGTTCGGTTCTATTAGGAC 1910/1911
3L5894718gt GT13 64f 8 0.76 24.38 121-141                         55.1 TTGCTGCTGCTGGGCGAC CCTGACTGCTCCCTTCTG 1908/1909
3L6588536ta TA11 65c 2 0.37 0.74 154-156                         51.7 TCCAATGCCTCCGACTG ATTCCGACTTCCGCCTG 1903/1905
3L6971599gt GT11 65e 3 0.40 1.02 106-110                         49.8 GTGCTGAACTACACTTGAC GCTTGTTACATTGTGGAC 1872/1873
3L7131033ca CA10 65e 3 0.12 0.25 136-140                         50.9 GCTCCTGATTTATGACCGT TAGTGTGCGTACTTTCGTC 1767/1768
3L8188376ca CA11 66c 7 0.57 33.83 117-135                         50.3 GGTAAGTTATGATATTGCTCG TTTTGATTGAGATGGAATG 1765/1766
3L8253482ca CA10 66c 3 0.32 2.42 138-144                         54.6 ATGAGACGCTCTTGCCAGT CGCCACCAAGTGCCGCTG 1763/1764
3L8256906ca CA8 66c 5 0.60 22.18 140-158                         50.0 GAATTAAAGTACGTGGCAG TTTGAATTGGGTCTCCAG 1960/1961
3L8939767ct CT10 66f 10 0.55 29.30 175-193                         57.3 CCGTCCCGCTCTGGTTTGG GTTGCTGCTCCTCCGCTGA 1761/1762
3L9097205gt GT10 67a 5 0.35 2.56 167-177                         54.5 ACTTCTATCCTGACGAGATGC AGTCCCGACAGATTCCCCACA 1759/1760
3L9166598ca CA13 67a 5 0.41 1.54 120-130                         51.9 TAGGATAAGTCTATTTTATGCCA AACCAGGATTCAGAACGA 1757/1758
3L9222187ca (CA)12 68A 7 0.64 21.45 180-202                         50.5 GCGATTTTCAGTGGCTCAATG TGGCTAATAGATTTCAACAAC 1415/1416
3L9736711ca CA12 67c 11 0.62 11.37 124-148                         51.1 ACGCACACATTTAGCCAC CGACATCATTATCATCGCT 1737/1738
3L9940844gt GT12 67c 5 0.58 14.02 118-128                         54.2 ATGCTTCATTGCGAAAGG TGCCACTATCTGCTGCTC 1735/1736
3R10493035ca CA12 88d 12 0.83 42.64 149-173                         51.5 GGTTTCCTTTGCCATACTAC TTAGGTGTTGGTTGGGTG 2143/2144
3R1099228gt GT10 83a 7 0.54 18.20 119-143                         52.0 GCTCGTCTGATTCTGCTG AGGGTGCTTGCTATAAGG 1739/1740
3R11178343ga GA13 88f 9 0.77 10.94 184-206                         54.3 GCTCTCGCTGGCTGAGTC GTTCAAGGACCCGAAGTG 2145/2146
3R1134712ta TA10 83a 3 0.10 0.20 122-126                         49.4 ATCATTCTGGATGGATGG CGCTCCGCTGGCTGCTGA 1741/1742
3R1241486gt GT10 83a 1 0.00 0.00 177                         53.8 TTGAGTAGTTGGGAATGAGG CCGTCTTCAGATGCTGCT 1743/1744
3R1302339ga GA10 90a 7 0.71 34.55 101-125                         50.3 CATCAGATTCGGCATAAG AACTGGAGCATGAAAAAC 2147/2148
3R1328340ta TA9 83b 2 0.02 0.03 84-86                         43.3 CGAGAGTCCAACCGAAGA GTCGTTTCTAATCAATGG 1745/1746
3R1377763ta TA11 83b 3 0.08 0.17 183-187                         45.9 TCCGTATCAGTTTCATACAG GACTAAGGCGTTACCTCTCG 1747/1748
3R15743903gt GT13 92c 8 0.64 15.94 124-150                         51.6 TGTTGACTTTGCTTCTCAG GTAGGAAATGCGGGTCTC 2151/2152
3R16177365gt GT10 92e 7 0.59 2.93 143-153                         50.4 TTGGTTTTACTGAATGGCTGAC TCAAGTTGTAGCAAAGTTAGAG 2153/2154
3R170235ta TA11 85d 6 0.57 3.11 172-182                         45.1 CAACCAGACAAAGAGATG TTATTCATACGACATTGC 2121/2122
3R17293667gt GT13 93e 7 0.39 2.12 105-119                         51.1 CCCGCACTTGACTGTCTG TGTTGGAAATGATTATGTTG 2179/2180
3R18049537ct CT11 94a 6 0.34 5.32 146-160                         53.8 AGCCTGATTGCCGAGCCA AGGTCAAGCAGACGACAG 2181/2182
3R18611049ca CA12 94d 8 0.47 6.18 155-170                         52.2 AAGGTGAAAGGTGCCGAG TGCGTTGAGTTGTGAATG 2183/2184
3R18948004ta TA13 94e 11 0.86 30.09 94-124                         43.5 TAGCAGCACTTCTTTCTC TGATTCGCCAAAATAGCA 2185/2186
3R1913487ta TA11 83d 2 0.20 0.40 133-135                         52.7 CCACGCTCCCAGACCGAC GCAACGCTAAGGCAACTG 1749/1750
3R19639736ta TA12 95c 9 0.64 5.79 118-138                         44.4 ATACAGGGCATTACATAC GATTGGACACTTTTCGGT 2187/2188
3R1983949ct CT12 83d 7 0.79 9.68 152-164                         53.7 ATATCGTCGCTAGACTGGAC GCGGAGTTGCTGAATCTC 1751/1752
3R20604755ta TA13 96b 6 0.43 2.51 100-114                         45.9 ACTTGCGTCAGGTTTATC AACTTGTCATGCCTTTGG 2189/2190
3R21156998ca CA11 96d 6 0.52 2.15 155-167                         50.9 TCCTGTCTCTTTCGCTAC TTTTTCAAATCCAGCCAC 2191/2192
3R2236335ca CA9 83e 3 0.66 3.01 123-127                         50.3 CTATGTGAGACAGAAATAGTTGC TTTAGTTTCGGCGACCGTG 1753/1754
3R22473342gt GT11 97c 8 0.49 4.07 113-127                         50.7 GAGTGACAAATGAACGCT ATCTGCAAAAACGGAAAC 2193/2194
3R2294192ta TA11 83f 4 0.59 1.71 179-185                         49.2 CTGGACATTGATGCCGAC AACTGTGAAATGTTCGCTG 1755/1756
3R23156893gt GT12 97f 6 0.65 15.58 128-140                         51.4 CACAAGCCCAAGCCCAAG GCCATTCAACATTCACTG 2195/2196
3R24298455ca CA13 98d 7 0.45 2.18 162-174                         52.5 TTCGTCGTGGATGTGTTG TTCATGGTTGTGGACTTG 2203/2204
3R24685103gt GT11 98f 5 0.68 8.74 122-130                         57.0 GGAAGCGGAAGTAGCAAGTAAG GCCACTCCACCCACTCAG 2205/2206
3R25077966ca CA12 99b 5 0.60 19.32 110-126                         51.8 AATCCCCTCAATCCTGTC GTCCGTCCAAACAAAGTC 2207/2208
3R25170975gt GT13 99b 5 0.50 94.70 80-106                         50.3 ATTTGTAACTGCGAGTGAG ATAACGGTAGCGGGTAAC 2209/2210
3R25777506gt GT11 99d 4 0.35 1.43 133-139                         50.1 GTGACAAACAGTTCAATAAAG CCCATTTCCATTTCCATTC 2211/2212
3R26329332gt GT10 100a 3 0.43 1.72 144-150                         50.2 GACATCAGCAAACTCACAC TTGACACATTATTCCCAATC 2213/2214
3R2742549ct CT12 84b 6 0.45 3.83 159-169                         51.5 AGATCCGAGATGCGAGATG GTGTGTGCGTGTAGATTGTC 1875/1876
3R2928292ga GA11 84c 6 0.58 3.02 150-162                         50.6 ATGGTGGGTTGGTTGGGT CGTTCACTTGTGCTTATGTC 1877/1878
3R3094270gt GT10 84c 4 0.58 2.10 115-123                         52.8 CTGCGATGATTCATGCGACC ATTACTTGAGGACACCCACT 1879/1880
3R3253306ca CA9 84d 2 0.02 0.03 137-139                         55.8 CGTGTGCTGATTAGTGCCAC CTCCCACTCCGCTAGGTTGC 1881/1882
3R3649224ta TA9 84d 3 0.39 0.87 143-147                         47.0 GCTGAATAAGCATAAGTAGG TTCCCGCATCAAATGTTG 1883/1884
3R4227045ct CT10 85A 5 0.62 2.51 136-144                         52.2 TCCCTTTCGTCCTGTTAG TTGTTATCCTTGCTGGCT 1920/1921
3R4244052ca CA10 85A 4 0.48 8.15 90-98                         49.1 TAGTATTGTGCGTTGCTC TGGTCATTAGGATGCTCT 1918/1919
3R4310689gt GT12 85A 5 0.54 3.28 149-161                         49.0 TTCGCCGTTCTATGACTG TATGTAGATTTATTGGGAATG 2109/2110
3R4356054ca CA12 85A 5 0.52 2.55 155-167                         54.2 GCCAGAGCCCAAAACAATC CCACTCGTTCTCCCAGATAC 2111/2112
3R4523012gt GT10 85A 2 0.29 0.59 145-147                         53.0 CAGGCTTTTATGCTGCTC ATCACTGACCCAATGAAATG 2113/2114
3R4659991ct CT12 85B 10 0.81 15.87 143-162                         48.3 TGAAGTGCTGAAAAGTTG TAATATGCCATTGTTGAC 2115/2116
3R4915877ca CA11 85C 5 0.62 21.10 129-147                         51.2 ACACAAACACACAGGGAG GCTTGCGTCTGCGGCTCT 2117/2118
3R5023852gt GT12 85d 6 0.72 4.46 181-191                         52.0 GGTTAGCAGTAGTCTGGGTCAC CATTTTGTTTGAAATTAAAGTTG 2119/2120
3R5316419ta TA10 85d 3 0.18 0.41 86-90                         40.7 TTTCGTTGTAATCAGATG TCGTACTCTTCATATCAG 2123/2124
3R5511972ca CA11 85E 4 0.13 1.18 136-144                         53.4 CACCCACCACCCCCTTTC AAGCGAAGAGCACAGCAG 1926/1927
3R5875601ct CT13 85f 9 0.72 12.07 140-158                         49.9 ACATACAAATCAAATCGCTC GTAGTTTTCCATATCAGCCA 1932/1933
3R5883378ct CT12 85f 8 0.40 11.40 170-186                         49.7 ATGGGCAACACAGAGAAC AGTATCTTAACCTTGAACTTG 2127/2128
3R6240203gt GT11 86a 6 0.58 3.79 148-158                         54.2 CCTTTGCTGCTCGTGCTG TACATTACACTCAAGCCCACT 1936/1937
3R6389752ca CA14 86c 6 0.46 16.48 99-113                         52.7 CCCGTTGGCTTTTATGTTG GGCGAGTTCCCATTTTATC 2129/2130
3R6762954ca CA10 86c 3 0.05 0.11 156-160                         51.9 GTTGTGCTGCCGCTGTTG TGATGAATTGTCATAAATAGGAC 2131/2132
3R7047859gt GT11 86d 6 0.29 2.62 151-161                         54.9 GATGGGTGAGTGTATGGGTG TCAAGCAAATGCCAAAAGAC 2133/2134
3R7668039ca CA10 87a 6 0.37 2.01 147-159                         49.3 AACCTTTCAACTGTCATTC AGTGCTCAAACAGGACAAAC 2135/2136
3R782884ga GA9 82e 2 0.25 0.50 135-137                         50.7 GCAACTAGAAAGAGATGGAC CGAAATACGGTAATGGAAC 1707/1708
3R8929639gt GT18 87e 3 0.42 83.69 98-125                         48.5 CTTGTATTGTTGTTGATGTG AATGCGAAAAACTCCTA 2137/2138
3R9352072ct CT12 87f 6 0.64 6.91 168-178                         50.7 CTGCGTGCTATCTATGTTC AACTTTTGCCACTGCGTTC 2139/2140
3R9742643gt GT13 88a 4 0.48 6.13 126-134                         52.6 ACAGAGAACTGAAACACAAGAC CAGGCAAGCACTCACTTAC 2141/2142
Antp 1 (GT)26 84B2-C2 29 0.93 51.07 122-208                         50.0 CGTTCGTTCATGGGCTTTTC CTCTTTAATATCGGGGTTGG 728/729
Antp-GT (GT)8 84A2-B2 3 0.03 0.07 135-139                         57.3 CCCGCCCCTTCCCTGCTAAC ATATGTGTCTGCGTCGTGTG 662/668
Antp-TA (TA)8 84A2-B2 4 0.47 1.06 160-167                         46.4 AGCCGCAAATACTTCCAAAC CAAGATTTCGTCGTTCATAC 701/702
Antp-TC (TC)9 84A2-B2 5 0.25 1.62 146-163                         50.0 GCTTTCGATCCCATAGATAC CGGGCTCATCTAATGATATG 663/664
AntpBZ (GT)13 84A 4 0.46 0.60 136-144                         51.5 AGTAGGGTTTCCATGAAAATCT TGTCGCTGCTGTCAGTCAG 779/780
Aprt.3 (GT)9 61F3-62B11 9 0.74 8.23 133-151                         51.8 CTGGGTTGAATGTTTGATTGGT ACCGAAAACAAAACGAGAAAAC 781/782
DMTRXIII (CT)23 88B3 37 0.95 23.77 92-150 5 0.65 5.99 100-110 1 * * 102 1 * * 102 55.3 AGGTGTGTGCGTTTGCTCTC GCCGAACGAACACGAAGATA 859/857
M12 (GT)27 82E 22 0.95 92.38 160-234                           TCCGTCTCCTTTGTGGCTAT CAGTGCAAAGAAAACGGTGA 169/170
Mdr65.1 (TA)14 64E11-65B5 13 0.86 57.87 88-120                         45.4 TGCGATAACGTAATTTACTGAC GCTCGATCAGATGAGGATTATC 783/784


Letzte Aktualisierung 28.06.2002