D. melanogaster microsatellites located on the 2nd chromosome

        D. melanogaster       D.simulans       D.sechellia       D. mauritiana            
Locus Repeat Cyt. location No. alleles Het. Variance Size range No. alleles Het. Variance Size range No. alleles Het. Variance Size range No. alleles Het. Variance Size range Annealing temp. Primer forward reverse internal reference
Cd36 (GA)17 21B7-21C3 1 0.00 0.00 156 2 0.23 0.11 158-160 1 0.00 0.00 162 1 0.00 0.00 158 49.5 tgtctaatcttacctaaatac atttatgctttaagctaagtc 346/347
Eno2 (TA)20 22A1-B2 17 0.86 26.19 111-147                         45.6 gctggtgcgtttccaagaag aagatgctgtgagaaataag 720/721
Eno-TA (TA)9 22A2-A5 12 0.73 5.04 146-169                         51.3 tgcattctggcgacgctgac aaatctcccacaaatgtcac 687/688
Eno-TC (TC)9 22A2-A5 6 0.20 3.30 123-136                         46.8 tcataattccatgttccacac taaatagtcacttagcttgaaag 665/666
Eno-CA (CA)9 22A2-A5 6 0.62 12.74 168-180                         51.3 taaaattgcacaacataacttg tccgtgtgcgtatgttcctgtg 618/619
Z50409 (GT)7 22B1-B9 3 0.67 7.39 126-138 3 0.39 0.94 125-133 1 0.00 0.00 129 4 0.59 0.43 125-129 50 gcaaaacggaaaagcaaaaga gtgtgttccacttccttctac 093/094
AC005749 (GT)4GG(GT)17 22B3-22C1 16 0.83 20.42 129-171 3 0.65 2.39 138-142 1 * * 140 2 * * 138-142 50 tacaaaaccgacgcataaaatac tagatacctagttcggctaag 924/925
Droyanetsb (TG)21 22C 15 0.74 16.69 84-122 3 0.51 0.29 80-84 2 0.26 0.13 86-88 2 0.17 0.09 82-84 55 taatggggaatgggtgaatg gccgtgctcttttctcttacg 151/152
Pkg-TA (TA)8 23A1-A3 10 0.56 3.38 111-122                         48.3 aatcaaagcaacaacaacagtg tgcgtagccgtgccatactc 716/717
Pkg-TC (TC)9 23A1-A3 7 0.73 7.39 104-118                         50.5 gaaaagcggaaaagccacac ttattttgttgccttctctg 446/447
Pkg-GT (GT)9 23A1-A3 11 0.62 45.50 139-177                         53 cctcgtattcaccccatctc tggagacgacgacgaacttg 448/449
DS01340 (AG)9T(GA)3 24A1-A2 7 0.65 1.65 176-190 3 0.69 0.62 159-163 1 0.00 0.00 165 5 0.74 1.78 172-182 55 ggagcgcaatgctgtttaagt ggagtagtgcctgtctcggac 149/150
Dm0600-TA (TA)11 24C3-D1 10 0.61 3.98 153-175                         50.6 ggaagaaagagagggagaatc tgtgggaaatgaaaacgaaag 681/682
Dm0600-TC (TC)9 24C3-D1 10 0.43 12.31 112-132                         50 accgtcaacaaaaagcatac gaaagtcaaaagccgcacac 444/445
Dm0600-CA (CA)9 24C3-D1 9 0.63 10.35 146-170                         50.8 tgcctccgaacctctgagac cctgcctctgtatctgtatc 442/443
ft-TA (TA)7 24E1-E4 5 0.10 25.68 132-196                         53 acaggctaagcggcaacaac gcgggtgctacgtgtgactc 689/690
ft-TC (TC)9 24E1-E4 16 0.70 25.75 154-178                         51.9 ctttgtcccctcattttctc aatggttggatgtggatgtg 434/435
ft-CA (CA)9 24E1-E4 5 0.46 18.90 130-144                         54.9 gtgggttgaaggggaagaag cgcagtggaacagccagttg 436/437
AC005270 (AC)19 24E1-F1 13 0.82 11.22 125-149 6 0.09 2.01 119-130 1 * * 125 2 * * 123-125 57.6 cggcagacgacacttgacac gagaccagccgccttgacta 858/859
Drogpdha (CT)7 25F5-26 A 3 0.47 0.08 132-134 3 0.52 0.19 129-132 1 0.00 0.00 130 1 0.00 0.00 130 53 cattggaaaagtgagcggat cggacaacaacaaatcgttg 153/154
DS00168 (GT)9 26A1-A2 1 0.00 0.00 106-114 3 0.57 0.39 117-121 1 0.00 0.00 117 n.a. n.a. n.a.   57 ccgcttcctgtccgcttgc ggcgggaagagcatttgtt 643/644
Acp26Ab (CA)13 26B3-B5 5 0.65 1.30 160-168 4 0.62 1.84 141-150 1 0.00 0.00 148 1 0.00 0.00 142 50 cacaaaggactcggcaagcac atcctccaaatgaaattacag 350/351
Dm2337.2 (TA)23 26F1-27C3 14 0.76 22.96 162-198 3 0.25 0.74 128-134 4 * * 152-162 3 * * 130-136 52.8 tcgaacgagaccgtagctgaat gccgcactcaaaactgccactg 852/853
Dm2337 (CA)15 27A1-B1 6 0.79 2.34 150-160 4 0.55 0.77 139-148 1 0.00 0.00 134 3 0.50 0.31 144-148 57.7 ccatttttccgccccaatgtc acggtgggaaagcgtggaaag 341/343
Droninac (AT)10 28A1-A3 3 0.45 0.26 136-140 3 0.42 1.22 133-140 n.a. n.a. n.a. 133 n.a. n.a. n.a. 130-140 56 tttgtcaatctctcacagcagg gcccgagtacatttattcaagc 155/156
su.var (TG)12 29A5-B4 6 0.68 4.18 164-176 6 0.65 13.60 133-189 1 0.00 0.00 172 2 0.52 0.26 162-164 56.2 ggttgctgggagaaagac gccacacattcgcatctc 414/415
DS08088 (TG)12 29C1-C4 7 0.43 1.54 127-141 4 0.37 0.99 134-142 1 0.00 0.00 136 n.a. n.a. n.a.   54.3 gaggcgacaggaagttttac ttgtgtttcgttccggtttc 629/630
Dm0332-TC (TC)8 29f 4 0.364 0.943 107-113                         54.6 tatcctgccaccactgaatc aactgtttgcgttgcgtgtg 656/657
DS01054 (GT)7 30A1-A2 1 0.00 0.00 172-182 5 0.51 1.42 164-174 2 0.07 0.01 163-164 n.a. n.a. n.a. 152-174 57 tcctgctcctcgggctttac aaaacagccacttcacacac 256/257
DS03018 (AC)8 30A3-A6 4 0.52 0.93 95-101 3 0.54 0.41 97-101 1 0.00 0.00 97 4 0.52 1.27 91-101 51.4 cgttcatgaccttgaaaagc gtgtgaaatgtaggggaaac 631/632
DS00058/2 (TG)13 31A1-A2 4 0.55 3.95 123-131 1 0.00 0.00 115 1 0.00 0.00 115 n.a. n.a. n.a.   57 tatgggtgggtagctgtgac caacgggaacgccatctaac 623/624
DS04172 (CA)8G(CA)6 32A3-D4 13 0.91 10.03 75-101 3 0.28 0.04 74-76 1 0.00 0.00 75 2 0.30 0.04 74-75 55.3 gaacggaaatcattcttctg cactacccagcactgcaagg 627/628
G410 (TC)11(TG)4 33E9-E10 12 0.74 14.07 124-162 5 0.56 0.68 122-128 2 0.09 0.39 126-132 3 0.45 1.04 124-132 53 ttcggctctttgtttgcttg aagcttaaaccgatcgaaaac 43/45
L49403 (TA)19 35B2-B10 19 0.85 58.38 139-235                         41.5 aacttgaggggttgattc gaagcgaagggggttttattc 854/855
AC004118 (TC)18 35B2-B3 16 0.78 7.28 109-141 1 0.00 0.00 96 1 * * 96 1 * * 96 51.2 gcacacggcgttcgcactct cgagttcacttgacttgtct 842/843
Adh-TA (TA)9 35B2-B4 6 0.58 1.99 163-173                         51.7 gcaactcaataaacccaatttc caaaaagccacaaatcgcagtc 675/676
Adh-TC (TC)11 35B2-B4 9 0.69 22.63 132-158                         54.6 cagcaccagcatccaagtac agtctctgtggcagtgtgag 430/431
Adh-TG (TG)11 35B2-B4 4 0.15 0.35 144-152                         51.2 ttgaaagtgttgtcgctctg acaaagaggaagagggcatc 432/433
6744 (CT)8 35E6-F5 3 0.26 0.14 90-94 3 0.40 0.23 90-94 2 0.14 0.07 92-94 2 0.25 0.12 92-94 56 cgctaagagtcgctctccat aaattgtttgcccgtctcac 322/323
cact-TA (TA)9 35F1-F6 10 0.59 8.85 146-178                         48.2 gcacgaaaacggaataacatag ggcaaaagaaaacaacggactg 677/678
cact-TC (TC)9 35F1-F6 5 0.15 0.47 110-118                         54.2 aaccagacgtagcgaaaaac aagagagggagcacaacatc 426/427
cact-TG (TG)9 35F1-F6 5 0.54 1.28 148-155                         53.1 ctatgaaacgatgggcaaag tgacattaaaagggcaaaac 428/429
L49408 (TA)25 35F5-F12 24 0.89 15.99 101-157 7 0.83 28.25 100-116 1 * * 104 2 * * 102-104 47.3 tcagagacatatccaaacacc acacacatttccattcctcag 922/923
DS00762 (GT)6T(TG)7 37B1-B2 3 0.53 1.91 114-129 4 0.52 0.66 114-120 1 0.00 0.00 117 7 0.83 10.97 112-134 52 gacagttgcaggcgcaccaac gtagcgtgtgcatttgacact 320/321
DS09065/1 (GT)14 38A1-A2   0.70 5.57 147-167 n.a. n.a. n.a.   n.a. n.a. n.a.   n.a. n.a. n.a.   55.3 ggtttcattccagcagaggg ccttcatttggcagcgtca 199/200
Dm0332-TA (TA)9 38B5-C2 7 0.65 1.05 130-137                         49 caacttcccgaacaccaattac cagcagttcattaaaccgacac 697/698
Dm0332-CA (CA)9 38B5-C2 7 0.38 32.60 118-146                         54.3 ggctctgtggaaaactcaac gtgtggacgtgcggcttttg 649/667
Cad-TA (TA)9 38D4-E1 8 0.72 11.68 153-169                         49.8 caactcatccccgaaataag acgaaaccgtgaaaagattg 679/680
Cad-GA (GA)11 38D4-E1 7 0.47 4.64 138-152                         55.7 aggcactctctgggcgaaac cgtcactaggtcggggtatc 450/451
Cad-CA (CA)11 38D4-E1 10 0.75 9.74 130-154                         52.8 gaaccccaagccgaggattg cacagccagaccagatgtag 452/453
DS07289 (TG)8 41E3-E6 2 0.48 0.24 130-132 1 0.00 0.00 122 1 0.00 0.00 122 1 0.00 0.00 122 54 ctcgttctgacgtccgtatc cttctctaatggcaaacacg 550/551
tor-TA (TA)9 43B3-C5 6 0.27 1.61 149-161                         48.6 atatgttcgcctggctacac atttctcttgtttggctatg 699/700
tor-TC (TC)8 43B3-C5 2 0.37 0.75 109-111                         56.2 aacgggagcaagagtgtaag ctttttcgccgccccagcag 660/661
tor-GT (GT)11 43B3-C5 7 0.53 8.21 146-160                         51.5 ccttgacatggcacagagtc tgatggaatgacaggctaag 658/659
tor (CA)13 43B3-C5 5 0.74 1.49 102-112 4 0.39 0.47 102-110 2 0.07 0.04 108-110 2 0.17 0.09 104-106 54 tgcagtcatcaatggctaatc tgatttcccccgtccgaagtg 418/419
5915 (CT)21 44D5-E4 6 0.46 6.08 114-130 4 0.75 1.32 104-110 1 0.00 0.00 104 4 0.58 3.09 104-118 54 atgcccctgactctctccac gagccggttgcatgtaag 316/317
Drogpad (GT)9 47A 5 0.52 1.99 158-191 6 0.52 1.14 157-165 1 0.00 0.00 148 2 0.17 0.35 152-156 56 gaaataggaatcattttgaatggc aattaaaaacaaaaaacctgagcg 157/158
Dmmp20 (CA)10 49F9-F13 4 0.57 0.22 86-93 4 0.62 7.88 71-88 2 0.14 2.48 76-88 3 0.71 1.83 76-84 55 catgcaaatgagcagtactttg tattttcacacatttccaatcg 159/160
Dm0620 (GT)9 51E5-E8 4 0.53 0.79 133-143 4 0.73 1.32 139-145 1 0.00 0.00 139 3 0.57 0.66 139-143 55 gagacaccccttgacgagtg ctcaaaacaaacccagtctc 406/407
DS00541 (CA)10 52C1-C2 4 0.32 0.60 138-148 8 0.76 21.10 132-158 2 0.21 1.64 130-138 4 0.49 0.41 142-148 57 gcacgaggtatcgcacaaag tccgtcgttcgctgctgggt 625/626
Sca1.b (GT)18 52D1-D15 9 0.73 2.65 147-167 3 0.26 1.25 142-146 1 * * 146 2 * * 142-146 54.2 aattcattccgtttttcaagtg accaaggtgtgggtgaagttgt 773/774
AC00556 (TA)20 52D1-D15 17 0.81 6.47 150-188                         46.4 gagtaaaaagacgctcagt tctactaccacccgataac 846/847
AC004516 (CA)18 52D1-D15 17 0.78 10.42 90-126 4 0.53 3.03 104-114 1 * * 112 1 * * 112 53 cttgctccacgcacttacac gcttgctgattttcgcatta 862/863
AC004248 (CA)22 52D2-D15 12 0.37 38.04 98-140                         58 aatttccctcgcactgacac tgcagcccgcacttccttac 866/867
sli (CA)21 52D9-D15 2 0.13 0.06 134-136 4 0.48 4.75 134-144 4 0.67 4.37 150-160 5 0.78 2.68 144-154 57.5 caatttccctcgcactgacac cggaaacgaacgggcgataag 422/423
Pkc53E-TA (TA)8 53D1-D5 5 0.10 2.19 124-137                         51 gtaacaacccatcccaagtg tcctcatggctcccgattac 693/694
Pkc53E-GA (GA)11 53D1-D5 12 0.50 8.08 117-149                         50.9 cagagaacagagcgagtgac ccgtaagcaccttccatgtc 440/441
Pkc53E-CA (CA)11 53D1-D5 15 0.74 251.79 120-144                         51.7 taatcaagtgcaatccaacaa tgcaaaacggaaccaggcagac 614/615
AC004641 (CA)22 53D1-E2 25 0.91 26.01 92-154 3 0.44 11.93 96-108 1 * * 106 3 * * 98-108 51.4 atcacaactggaccctctat aatttcacaaccaacaacta 860/861
DS00361 (CA)8 54B1-B2 6 0.37 6.63 132-155 7 0.81 6.96 143-159 1 0.00 0.00 151 6 0.79 1.81 143-154 52 caaccacccacaagcacac cctctccggttgggctac no CS 917/918
DS00361c (TG)7 54B1-B2 4 0.33 0.55 120-128 3 0.49 0.31 122-126 1 0.00 0.00 124 4 0.64 0.66 122-127 51 cgttaagcgtcgaaaatag ctttagcactttgcattcc 554/555
DS00144 (CT)8 55A1-B1 3 0.10 0.02 115-117 3 0.66 0.56 115-119 3 0.33 0.79 113-121 3 0.54 0.32 115-119 52 gctcagacccaaatggcgtag aaactcaaactctccagcgag 91/92
Ote-TA (TA)8 55A2-B1 4 0.23 0.79 141-147                         48.3 aaaggactacagcagcactc agacagcggctcagggtaag 691/692
Ote-GA (GA)11 55A2-B1 7 0.53 4.66 106-118                         55.4 gttgattgcttgacaaattgcc ctgccccctgtcgccatttctc 620/621
Ote-CA (CA)12 55A2-B1 13 0.74 24.17 162-198                         49.7 gcagtcgcaacgtagggagaag agtatgctacacgaatttgaag 616/617
Dpt-TA (TA)8 55F1-F6 15 0.80 12.47 150-171                         49.7 agaaaagcggcaaccaagtc tctcacttccccctctttac 681/682
Dpt-TC (TC)9 55F1-F6 4 0.04 0.16 174-180                         53.9 gcaactcttgcgtttttatc gaccacctcgctccctcttg 456/457
Dpt-GT (GT)9 55F1-F6 8 0.56 4.98 126-139                         50.6 gcaaaccgttttccatttac cataactaactggggacttg 612/613
DS08687a (TG)11 57C5-D1 5 0.38 0.52 180-186 7 0.72 7.19 168-186 3 0.41 3.54 176-188 4 0.71 2.68 176-186 54 tgatttggactgagatcagg gcccaacgaatcatttcac 313/197
DS08687b (GT)9GC(GT)3 57C5-D1 10 0.79 2.75 156-173 3 0.42 1.76 134-145 3 0.17 0.21 135-139 6 0.83 10.94 114-143 52 tgtcgagagcagcagcagt ttgccttccctgttacag no CS 891/892
AC002446 (TC)18 58B1-B2 14 0.71 9.40 144-188 5 0.74 5.76 136-144 3 * * 146-150 2 * * 138-142 51.2 tccttattcggtctacaaatct atacacatgcacatccgtatag 840/841
Dm1639-TA (TA)9 58B10-C4 8 0.65 4.98 153-175                         50.3 aaacaaaagcctgtcaagtgtg tgtagtcaaggaggtttgagtg 730/731
Dm1639-TC (TC)12 58B10-C4 8 0.66 5.88 102-120                         55.2 gcctcgctccgtcccgttcc cgattgtttccattgttcac 535/536
Dm1639-CA (CA)11 58B10-C4 13 0.58 39.01 139-177                         52.9 cattggtttcttccgttttc cgtgccaggttgccttttag 533/534
Z32225 (GT)10 58C1-C7 4 0.16 5.67 202-248 n.d. n.d. n.d.   n.d. n.d. n.d.   n.d. n.d. n.d.   52 atggcaaccactgctgacac gcatcctggaagtcctttag 99/100
Z31849 (GT)10 58C1-C7 3 0.48 2.32 137-147 n.a. n.a. n.a.   1 0.00 0.00 134 2 0.19 0.09 131-133 53 cccattaaggccgataagtc gagatagctctgtttgccag 101/102
G411 (CT)6(TG)4 58D1-2 3 0.40 0.23 158-162 6 0.77 3.10 156-168 2 0.24 0.27 160-163 4 0.78 0.56 160-164 50.5 attgctgtttggagtttgttg ggtcgcagggacacaattcac 46/47
DS08011 (GT)8 59A1-B2 7 0.78 6.59 102-122 5 0.62 6.18 100-112 1 0.00 0.00 104 1 0.00 0.00 102 53 agccacagccatgcgtttaac cacacgctgacaggatctact 70/71
Dromhc (CA)13 60 E9 5 0.73 0.60 101-106 6 0.72 3.02 89-101 1 0.00 0.00 91 4 0.72 2.16 91-99 57 aaacccacacaacaactgca gacattaccgatattggatgca 161/162

Letzte Aktualisierung 19.06.2001