Citellus/Marmota microsatellite loci

      Spermophilus citellus       Marmota marmota          
Locus Repeat No. alleles He Ho size range No. alleles He Ho size range Annealing temp. Primer forward  reverse
SC2 (GA)31 1 0.00 0.00 146 2 0.50 0.50 128-130 56 CATCATGGCAGAAGATGTGG TTGACTGGAAGTGGGACTCTC
SC4 (GT)20 1 0.00 0.00 102 2 0.53 0.00 134-145 56 AAAAGCGTGCATTGCCTTAC CCTCTCAAGACGGGCAGA
ST7 (TGG)7 T (GT)2 AT(GT) 7 AT(TG) 8 3 0.55 0.44 151-156 5 0.60 0.87 135-154 50 GAATCTTGACTCCTGAGATA CCATCTCCTGACATTTAATA
SB10 (GA)12(TG)18 4 0.73 0.65 150-162 1 0.00 0.00 154 50 TCTGTTTAGTTCATTTGCCATTT TCAAGAGAGGTCCTACAGAATGA
ST10 (CA)12 3 0.51 0.62 127-134 4 0.63 0.83 124-130 52 TTGTGATCCTCCAGGGAGTT GTGATTTCCAAACCCCATTC
Sx (GA)25 3 0.60 0.61 142-146 2 0.50 0.50 142-146 56 TTTTCCTCTCCTGAATGAATGCTTTT CAAAGATGTTGTGTCCGACG

 

These loci have been published in Hanslik & Kruckenhauser

Last Updated on 29.03.2001
By Stefan Hanslik