D. melanogaster microsatellites located on the X-chromosome

        D. melanogaster       D.simulans       D.sechellia       D. mauritiana            
Locus Repeat cyt. location No. alleles Het. Variance Size range No. alleles Het. Variance Size range No. alleles Het. Variance Size range No. alleles Het. Variance Size range Annealing temp. Primer forward reverse internal reference
X506493gt (GT)10 01C 3 0,16 0,33 174-198                         55,8 GCTTTCCGCCCACTCCCTG TTAGCCGCACATTGATGCTG 2173/2174
X651868ca (GT)10 01C 6 0,57 3,85 105-132                         48 TGTCTGAAGTTTTGTATCGTC TTAGTATTATACCCTCTTTCG 2167/2168
X728937ca (GT)11 01D 3 0,45 0,68 149-169                         52,6 GGGTCGGGTCAAGGATGGTG TTGCTCACTTTTGGGAAG 1687/1688
X742605gt (GT)13 01D 5 0,48 2,05 134-160                         55,4 ACACGAGCACGCACACATC ATTTGAATGACGAATGGCTGG 1693/1694
X750934gt (GT)13 01D 3 0,25 0,60 131-159                         55,7 TGC TCA CTG CTC ATT GTA CCC TGC CGG GGC GGA GTG GAG TGG 2163/2164
X884191ga (GA)12 01E 3 0,29 0,19 157-177                         50,9 ACTGTATCTTGTCGTGTAAGC CCAACCTGGCAACTCTGA 1695/1696
X986182gt (GT)11 01F 2 0,08 0,21 148-166                         55,5 CCTTTTGGCTTATCGGCTC GTGTCCTCCTGTCGTCCTG 1677/1678
56G7-AC (AC)10 02B 4 0,12 0,68 104-114                         52,1 AGCCTTTTTGAACTTTGAAC CAAAACTACCAGCGAACCAG 745/746
X1481559gt (GT)12 02B 2 0,18 0,35 118-144                         51,2 TAAGAGTGTGCCTGTGTGAG CTAAAATGGGTGTAAACCTG 1689/1690
56G7-AT (AT)10 02B 4 0,48 1,41 107-123                         49 GTGGCGTGGGTGGTGGATAG AGTGGAATAAAAGCCGAGAG 741/742
X1721159gt (GT)11 02C 3 0,15 0,36 159-191                         56,9 GAAGTGTCTGCCAGTTGAATG GAGTGCCGACTACTGCCCTAC 2171/2172
X1883543gt (GT)12 02D 5 0,39 0,86 137-149                         52,4 ACGAATACGAAAATCCGAC GGGAGAAGTTGAAGTGGAG 1699/1700
X2052732ca (GT)11 02F 3 0,08 1,07 96-122                         51,7 AGAGGGCGAAGAAGAAGAG CCGTTTAACTTTGTGTGC 1681/1682
DMC30B8 (TC)21 02F 3 0,35 0,28 140-144                         53 ATAGCATTTGCCAGTGCCAGTA TTGCTCGCTCGCTCGCTCACTC 799/800
DMC30B8 (AG)17 02F1-02F6 14 0,79 9,96 130-162 2 0,49 0,99 103-105 1 * * 107 1 * * 105 53 ATAGCATTTGCCAGTGCCAGTA TTGCTCGCTCGCTCGCTCACTC 799 / 800
X2102441ct (CT)15 02f4 20 0,59 12,75 110-160                         55 AAA GAC CTC CTG TCT GGT AC GGA ATG AGT TTG TGC CAC 1770/1771
X2297267gt (GT)9 03A 4 0,60 2,18 134-150                         54,5 AGCATCTGGGAGGCAGCATC TGGTAACTCAACAGACGAGC 2175/2176
DS01001 (GT)9 03A1-A4 18 0,71 10,80 208-241                         53 CCAACGCAACGCAACCAG CTCCCACCCAAAATGGAAATA 258/259
X2307713ca (CA)16 03a7 16 0,74 17,88 162-194                         58 CCC ATA CAG ACA GAC GCA CG ATT GCC ACG CCC ACT TTA TC 1772/1773
P3B02 atc (ATC)8 03b 7 0,09 0,66 73-103                         51 CGA CAG TGA TGC GAG AG AAA GAT GCC GAT GTA AAT G 1296/1297
P3B02gt (GT)6 03C 11 0,00 0,00 123-152                         55 CAG CCT AAA CAC AGA ACA GAA G TGG ACA GAC AGA CAG ACG G 1298/1299
56g7-AG (AG)9 01E 3 0,19 0,15 114-120                         49,8 ATTTGATTAAAGTCCCAGTC AAATTCCCCAAGGTGGTCAC 743/744
P3B02 atc (AT) 03B 2 0,09 0,16 85-100                         50,6 CGA CAG TGA TGC GAG AG AAA GAT GCC GAT GTA AAT G 1296/1297
X2571651gt (GT)13 03B 4 0,37 3,90 101-157                         53,6 CACATCCTGTCTTCTTCTTCTG CGGCATCGTTACACCTCAC 2169/2170
X2609012gt (GT)19 03C 17 0,66 15,75 127-163                         54 TAG TGG ACT CAA AGA CAC ATA C GTC AAG AGG TGT TGT CTG CC 1774/1775
66-95-3 (CA)12 03C 3 0,14 0,63 134-142                         57 GCACAATCACATCGTATTCACTCAGCCAGA ATTGTTGTTGCTGCGATTTTCAAATCAA 260/261
95B7-AT (AT)9 03C 3 0,48 1,20 124-134                         50,6 ACTGGGAACGCTGCTTGATC TGCCAACTGTTTTGCTTGTC 748/749
95B7-TC (TC)10 03C 6 0,52 0,88 117-137                         51,2 GCGAGTAAGAGAGCAAAGAG AAAGCGACAGGGCGGGGTGG 752/753
95B7-TG (TG)8 03C 6 0,52 6,69 144-161                         53,6 GCTTTGTTGCCGTGGGAGTC AAGTTAATTTTCGCCGATGG 750/751
DS06335a (GT)15 03C1-C6 8 0,76 5,57 87-107 3 0,34 0,75 91-99 1 0,00 0,00 97 7 0,89 5,09 93-105 53 ACTGTAATTGCTGTTCTATGT CGCACACTGGGACACAAAA 108 / 62
DS06335b (CA)12 03C1-C6 4 0,34 1,78 136-145 2 0,06 0,03 126-128 1 0,00 0,00 126 4 0,27 2,03 114-130 50 GCACAATCACATCGTATTCACT ATTGTTGTTGCTGCGATTT 1147/1148
AE002566_gtc (GTC)10 02A 10 0,27 6,83 85-112                         58 ATG TCG CCC ATT GCC AC CCG CCA GCA CGA CGA G 1308/1309
X3439769ca (CA)15 03d1 13 0,56 36,61 123-150                         55 GCG AGT GAA GAG GGT ACG CAC AAC ATG GCA AAT ACA CGG TCG 1780/1781
X3343263ca (CA)13 03e2 13 0,54 15,82 68-108                         58 GCG TAT GAG CAA TGC ACA AAC GGA CCA ACT GCC CAC CTA TAC 1796/1797
X3642495gct (GCT)11 03f1 16 0,40 6,32 88-139                         58 AGTGGTTGATTTGAGCACGAG GTTGCCATTACCCAGCATCTG 1782/1783
X3525583ta (TA)15 03f2 10 0,35 1,25 64-116                         50 TTG CCC GTC TGT GTG CTT TTC AAT CCA CGT TAA CTT TCA TTG 1798/1799
X3202250ata (ATA)13 03f7 7 0,36 2,13 140-161                         50 GTG CAA ATA GAA AAT AGC TG ACA TTA TTT TGA TGG ACT TG 1792/1793
X3655941ga (GA)12 03f9 17 0,66 8,34 98-138                         55 CTG AGA ATC GAA TCG GAG TGC GGG AGT TTG TCT TGT AGT AGG 1804/1805
DS00036 (CA)10 04A3-A5 4 0,55 1,03 95-101 n.a. n.a. n.a.   n.a. n.a. n.a.   n.a. n.a. n.a.   48 CCCCGCACACACACACACATA TGCTTATTGTTTAATTTACCT 639 / 640
DS00146 (GT)10 04A4-B2 2 0,26 0,13 117-119 3 0,34 0,73 103-111 1 0,00 0,00 109 3 0,39 3,69 99-113 53 GAGTCAACGAGCCAGCAAAGT AACAATACAGAGCAGCACACG 111 / 112
X3999387ca (CA)15 04b3 19 0,74 23,17 82-116                         56 CCA ACA ACT GGA ACA TAA TTG AGG TGC GAG CAA CTA AAA GTG 1814/1815
X4071888gt (GT)16 04b4 20 0,33 21,52 124-172                         55 CCA CGG CGA AAT CTT ATC AAA C ACC ATC TCA GGG CTG GGG ACC 1816/1817
X4275758gt (GT)12 04c4 11 0,34 5,67 90-112                         55 CCC CCA TCA ATA CAT TTG TAT G ATT TTT GCT GAA AAC TCG TGC G 1818/1819
X4364768gt (GT)13 04c8 18 0,56 4,87 128-156                         55 GAT CAC TCA GAT CGG ATG G TCG CTA GTG TGC AAA CAT C 1820/1821
AE002566_ca (CA)25 04c9 40 0,88 200,27 76-175                         53 TTA GCA GAG GCA AGA ACC TAC TCG TTC GGT TGT AGT GG 1314/1315
X4500516ga (GA)13 04d2 10 0,57 4,39 137-157                         58,5 TGG TGC TTC GCA GCT TCT C GGA GCG AGC GAG ACG GCA G 1822/1823
X4814651ct (CT)12 04d3 16 0,59 19,00 96-142                         2-Step:68/94°C GCA AAC GTG TGC CAA GCA GTG ATG CTT AAC GCA GCG GCA GTG 1826/1827
X4944599ca (CA)14 04d7 13 0,48 3,95 97-129                         55 GTC CTG CTG CGT TGA TTA AAC TAG ACA CCC TGA ATG TGA ATG C 1828/1829
X5179712gt (GT)15 04f3 16 0,57 23,17 129-173                         53 GAG TCA CCT AAC GAT TCT TGC ATG TTG CAG GTT CTT ATG ATC 1836/1837
X5326452ct (CT)16 05a2 14 0,80 50,66 122-150                         58 CCT GAT CGT TTC GTC CCA CTG AAT TCT CCC ATC GTT ACA CTC G 1834/1835
X5592060ca (CA)14 05b8 14 0,68 12,84 125-153                         2-Step:68/94°C GAT GAA AGC GAG AGT GGG CAG C ACC ATC GCC CAT TGT CCC ACT G 1840/1841
DS00589 (CA)11 05C1-C2   0,56 8,50 95-95 n.a. n.a. n.a. 78 n.a. n.a. n.a. 80 n.a. n.a. n.a. 78 52 CGTTTTTTATTTGCGGGCAG ACATCCCTCTCTTTCGCTTC 163 / 164
X5710427 (TG)5(AG)3 05c5 4 0,03 1,49 152-166                         53 GTT GAA TTG CGG CGG CCA AGT AAA TGG AGA AAA CCT TCG AGC 49/51
X5973753gt (GT)17 05d3 19 0,50 11,29 126-174                         52 ATC TTC AGC TTG CAG CCT TTG GTG GCA TAA AAT AAA TAA ATG AC 1842/1843
X6325133ca (CA)12 06a4 15 0,62 11,19 68-109                         51 GGA TGT TCA AAT GGT TCA AGG CAT TTT CAT AAG ACG CTC AAC 1846/1847
DS06329 (GT)12 06C1-C2 4 0,68 7,63 78-92 n.a. n.a. n.a.   n.a. n.a. n.a.   n.a. n.a. n.a.   54 CCTGGTTGCTCCCGCTGC TTCCGAGATCACCTGAGA 637 / 638
DS04440 (GT)9 06E1-E2 3 0,54 6,91 112-128 2 0,10 0,05 107-109 n.a. n.a. n.a.   n.a. n.a. n.a.   55 TTCTCCCACCGTAACGCCCTAT ACACAACATCCGTTGCTGCTGT 227 / 228
sex lethal (AT)9 06F4-7B3         n.d. n.d. n.d.   n.d. n.d. n.d.   n.d. n.d. n.d.   44,5 TTTTGTCGTTTTCGTTATG TTTGTATGTTCCTCACTTTA 3 / 2
X7028104ga (GA)16 07a7 14 0,70 7,51 116-142                         55 CTG AAC TCC AGA GAG AAC TGC GAC AAT GCT CCA CAG ATC CTG 1852/1853
X7192669ca (CA)12 07b1 12 0,30 1,53 101-123                         52 TTT GTG AGG CTG TCA TGT GTC TCG TGT AAC ATA AAA TCT TGT GG 1854/1855
X8022709ca (CA)15 07b18 15 0,36 6,75 100-146                         52 AAC ACT GGC AAC AAA TAA ACT C ACG TTT TCA AGT CGA GTG TTT G 1864/1865
X7586980ca (CA)14 07c2 11 0,27 9,56 114-134                         55 CTG CAA ACT TGA CGA CAA AAG CGT TTT TAG CCA ATT CCA ATG 1858/1859
81C6 (CT)8 07D 4 0,62 0,97 240-246                         54 GCTGCCCCTCTTCTACTCTC GCCCTCCTTTACTCCACAGAC 39/40
X7809164ca (CA)13 07d3 15 0,40 5,78 94-128                         55 AAA GAA CGT GTT ATT TAT GGT C CGT TAG TTA TTA CTT GGC ATC 1862/1863
DS09021 (GT)12 08B5-B8 8 0,81 36,19 148-180 3 0,57 0,37 140-144 1 0,00 0,00 140 1 0,00 0,00 146 52 TTCCCGCATATGTGTGAG TTTCGTGTACTTCTCGGTGC 105 / 106
X8756567gt (GT)12 08c3 11 0,36 5,48 174-197                         55 TTG TGA AAT GCG GTC ATC TAC ACA GAC AAT GCG AAC AAA GGC 1485/1364
Dm2004-TA (TA)9 08D 6 0,58 1,05 147-166                         47,8 TTGTGTAAGCCGTGTGTATC CCGCTGCGATTGCCCGACTG 758/759
P08E01gt (GT)12 08e 8 0,23 6,49 100-116                         55 AGGCATATCAAGACGAAT CTCTGGCGGTTCAGGAC 1235/1236
Dm2004-CA (CA)8 08E 4 0,55 7,24 122-128                         52,1 CTTCCCTCTCGTTCGCACTG TTGTGTAAGCCGTGTGTATC 756/757
Dm2004-GA (GA)8 08E 5 0,24 0,13 146-150                         50,6 CGTTTTGGTCGTTCTTGTTC TCGCTCTGTCTCTTGTGTAC 754/755
X9312943 (GT)14 08e8 21 0,35 10,74 157-190                         55,4 ACC CCA TTT TTG CTA CGC CTC GCA TTA GGG ATA ACG ATG TGT 872/873
X9317809 (AC)12 08e8 14 0,59 15,80 115-147                         49,7 CAT TTT ATG ATG CCA CCG AAC AGC CGT ATT TCG TAT TTT ATG 880/881
X9325355 (AC)2GC(AC)2TC(AC)6 08e8 11 0,22 2,00 82-100                         52,3 CTG GCT ATT TCG TTC TTG AAG GTG TGC AAG GCT GCG TAT ATG 888/889
X9325868 (GT)14 08e8 18 0,54 41,88 96-127                         52,5 CTA TTT CAT TGA CCG CCT CTG ATT TAG CAT ACG CTT CAC TTC 892/893
DS01391 (GT)10 09A1-A2 4 0,32 4,31 127-141 1 0,00 0,00 125-125 1 0,00 0,00 136 1 0,00 0,00 125 57 GCCTGCTGCAGTCGCATGTG CCAGCGGCATACGTGTAAAC 633 / 634
DS00907 (AG)13 10A1-A2 3 0,60 1,15 232-238 n.a. n.a. n.a.   n.a. n.a. n.a.   n.a. n.a. n.a.   56 AGATAGAGCGGCTGGCAACA AGCAGAGCAGAGCCAGCACTT 238 / 292
X11347407ca (CA)12 10c3 9 0,09 1,53 122-146                         58 CTG CCT GCT GTT CGT TGT GG CCT ATA ACC ATT ATG CCC ACC CAC 2247/2248
DS01551 (CA)10 10D5-E4 2 0,26 0,13 197-199 3 0,18 0,27 193-197 2 0,07 0,04 193-195 1 0,00 0,00 193 51 CAACAACAAAAACAGCAACGA TGCCAACTGCAAAAACACAGA 145 / 146
Dmtena (TA)4CC(AT)14 11A6 6 0,70 1,98 91-101 2 0,06 0,50 79-87 2 0,14 0,07 89-91 1 0,00 0,00 87 55 CTCTTAGTGCGCAGGGATTC GAGTCGCTCAATGGCAGG 66 / 67
P11B01ca (CA)9 11b 9 0,56 13,37 119-135                         51 ACATCGCCAGGATTCAC TCCCGTTTACAGCAACAA 1241/1242
P11B01ta (TG)10TA(TG)6 11b 15 0,66 29,77 98-144                         50 AATGATCTGTCGCATATACC TTTATGAAAACAACACATGC 1237/1238
P11B01tg (TG)11 11b 9 0,56 13,34 118-134                         56 GCTTTGCTAATGTCGTGTTGT GTGTCCACTGTGCGGAG 1239/1240
X12358328ca (CA)12 11b13 9 0,51 12,30 108-124                         60 TGG ACT CCA AAA TTC AGG AAT G CCC ACA CAC ATT TTC TAA CAG C 2255/2256
X12683051ct (CT)15 11c1 15 0,68 4,03 176-190                         55 ACA TAG GCT CCA TCT CAT TC AAA GCG ATT TGA AGT TGT GC 1367/1368
X13039889ca (CA)15 11e3 21 0,73 22,94 87-137                         58 GCT TTA CGG GTC GGT CGG TC ACT TGC CTT TCA AAT GGA TGG TG 1486/1487
X13203739gt (GT)20 11f1 21 0,71 100,27 150-214                         55 GTG AGT GGG TGG CAA ATA CTG GAG TTA CAA CCA AAT GAG TAA GAT G 1488/1489
X13624957 (TG)7 12c1 12 0,06 0,13 112-138                         49 ATA TAT CCT AGG GAT TTG GG TTG GAA AAG CGA AAA GTA AG 194/166
DS00314 (TG)8 12D1-D2 1 0,00 0,00 163-221 1 0,00 0,00 148-158 1 0,00 0,00 156 1 0,00 0,00 150-158 48 GTGACTGTGTTGATTCCGTG TTGGAAAAGCGAAAAGTAAG 165 / 166
X14128213ca (CA)15 12e4 25 0,79 38,87 154-208                         58 AAC TTT CGC CAC CAG TGT CTG AAT ACC CAG CGG AAC GAG AAC 1494/1495
P12F01ca (CA)16 12f 16 0,69 31,72 85-127                         53 TTGTCGTCACCTGGGAAAG GCCAAAGGGTCATCAGCA 1231/1232
X14425888gt (GT)13 12f1 10 0,49 14,55 126-144                         58 TTT TGG TAT GTG AAT GCG GCT G GAT GGA GGC TAA GTG CGG AAC G 1496/1497
X15146508gt (GT)11 13c5 16 0,38 3,07 123-143                         52 TTG TGT GAG TGT AAG TGT GCG T GTA AGT TTA TTC TCT TGC GTT C 1500/1501
X15279912atc (ATC)12 13e1 13 0,65 106,07 92-122                         57 TGC CAG ACG CCA TAA TCA TCA C AGT GCC TTG GTC ATT TGC CTC G 1502/1503
X15544500ata (ATA)10 13f1 11 0,17 1,23 95-109                         50 GGA TCT GAA ACA GAC CGT GG AAC TTA GCA CAC ACG AAC GC 1506/1507
3641.2 (GGT)5 14A 9 0,74 19,27 101-131                         55 GATTTTCTCGTTCAGCACG CGCTGTTCAAAGAAGCACT 21/22
3451.2 (GGT)5 14A3-A5 9 0,74 19,27 101-131                         55 GATTTTCTCGTTCAGCACG CGCTGTTCAAAGAAGCACT 21/22
X15830711gt (GT)11 14a6 18 0,27 173,98 52-168                         55 TCT CTC ACT TTT GAC ACT CTC C ATT TTA TGT TGT GAA GAG CGA C 1508/1509
X16167081gac (GAC)6 14c6-14c7 3 0,03 0,12 129-134                         58 TTG AGC AGT TGA GCG GCG TCT C TTT ATC GGC ATG TCA TCT CGT C 2055/2056
X16203512gt (GT)13 14d1 8 0,13 3,57 136-154                         52 GTT CGG TAC TGT TGT CGC TTT ATA TTA GAG GTT ATG TCT CAT TTT G 1375/1376
X16219444gt (GT)7 14d8 3 0,00 0,00 116-166                         55 TAT ACG ATA ACT GCT CTG GGT G TTG CTA TCA AGA AAG GAC CTA C 2057/2058
X16416576ta (TA)15 15a1 17 0,60 16,00 169-295                         52 ATG AGT GTG ACA TTC TTT CG AGA GGT GGA GGA ACT TGG C 1377/1378
DS09020 (GT)8(GC)4 15A1-A4 4 0,47 0,75 138-144 4 0,44 0,63 125-131 1 0,00 0,00 127 3 0,43 2,32 125-134 51 CTAAACAGGATGCAGGACAAC GCGATCAAGGTTAAATGGTTC 147 / 148
DS00265a (GA)11 16A1-A6 5 0,72 2,78 119-130 n.a. n.a. n.a.   n.a. n.a. n.a.   n.a. n.a. n.a.   58 AGTGGGTTTCCTCGGCGTGC TTTGCCCACTCAGCTTGCTTCG 229 / 230
DS00265b (AT)5 16A1-A6 7 0,74 9,48 119-130 n.a. n.a. n.a.   n.a. n.a. n.a.   n.a. n.a. n.a.   51 AACAATGCTGGCGACTTCAAG CTCCTCGTTCTCCGTCCCTTAT 231/232
X17276522ct (CT)19 16b1 13 0,65 4,29 111-145                         55 GAT TCT TGT TTA TCC TCC AGC CGT GTC CAG TTC TCA GAC TTG 1381/1382
DS08088 F (TG)12 17A 7 0,43 1,54 127-141                         54 GAGGCGACAGGAAGTTTTAC TTGTGTTTCGTTCCGGTTTC 629/630
X17869774gt (GT)14 17A 13 0,46 9,82 84-117                         58 CTG CGT GAG TGC GTG CGT GC CAC TGT CCC CAT CCA CAT ACC G 1385/1386
X17869774gt (GT)14 17a1 18 0,48 32,30 84-123                         2-Step:68/94°C CTG CGT GAG TGC GTG CGT GC CAC TGT CCC CAT CCA CAT ACC G 1385/1386
X18472039ca (CA)16 17d3 11 0,08 1,09 130-162                         55 ATC AAA TAA CAA CGA CGA GG CGG ACC ACT TGC CAG ATT G 1391/1392
X19942721gt (GT)18 19c4 21 0,73 58,63 117-150                         57 CTG CTG CCA ACT CCA TTC TG TTC TGC CAC ATT TGC GAT TC 1395/1396
X20174995ca (CA) 19E 4 0,50 1,96 50-85                         53,7 CGA CTT ACC TTT GCG TCC AC TAA CAG GAC CCA ACT GCG AC 1397/1398
X21100995gt (GT)11 19F 4 0,58 0,93 104-116                         51,7 ACGCCTACTTTCCACCATC TCTGGCAACTCGCACGCAC 1685/1686
X21147800gt (GT)13 19F 3 0,28 1,04 123-143                         46,7 AATCATTAGCTTTCTAGTAAATAC TTTGCATTATCCGACTTACGTTAC 1697/1696
X21297264gt (GT)12 19F 2 0,09 0,24 132-160                         50,8 CTTCCTCATCACCTTCGT CTAGGCAACACCTCACTG 1683/1684
X21300817ta (TA)10 20A 4 0,40 0,74 88-162                         46 AGC TTC TGC TGC TGG CTT TAT CTA AGT CTG TTT TAT ACT AAA TAC AAG 2165/2166
X21408452ta (TA)9 20A 3 0,32 0,68 105-125                         47 TTCGTTTGCTACAATCACCGCTC AATATAGGATAGATATCCCATTCC 1679/1680

Letzte Aktualisierung 23.07.2002