D. melanogaster microsatellites located on the X-chromosome

        D. melanogaster       D.simulans       D.sechellia       D. mauritiana            
Locus Repeat cyt. location No. alleles Het. Variance Size range No. alleles Het. Variance Size range No. alleles Het. Variance Size range No. alleles Het. Variance Size range Annealing temp. Primer forward reverse internal reference
X506493gt (GT)10 01C 3 0.16 0.33 174-198                         55.8 GCTTTCCGCCCACTCCCTG TTAGCCGCACATTGATGCTG 2173/2174
X651868ca (GT)10 01C 6 0.57 3.85 105-132                         48 TGTCTGAAGTTTTGTATCGTC TTAGTATTATACCCTCTTTCG 2167/2168
X728937ca (GT)11 01D 3 0.45 0.68 149-169                         52.6 GGGTCGGGTCAAGGATGGTG TTGCTCACTTTTGGGAAG 1687/1688
X742605gt (GT)13 01D 5 0.48 2.05 134-160                         55.4 ACACGAGCACGCACACATC ATTTGAATGACGAATGGCTGG 1693/1694
X750934gt (GT)13 01D 3 0.25 0.60 131-159                         55.7 TGC TCA CTG CTC ATT GTA CCC TGC CGG GGC GGA GTG GAG TGG 2163/2164
56g7-AG (AG)9 01E 3 0.19 0.15 114-120                         49.8 ATTTGATTAAAGTCCCAGTC AAATTCCCCAAGGTGGTCAC 743/744
X884191ga (GA)12 01E 3 0.29 0.19 157-177                         50.9 ACTGTATCTTGTCGTGTAAGC CCAACCTGGCAACTCTGA 1695/1696
X986182gt (GT)11 01F 2 0.08 0.21 148-166                         55.5 CCTTTTGGCTTATCGGCTC GTGTCCTCCTGTCGTCCTG 1677/1678
56G7-AC (AC)10 02B 4 0.12 0.68 104-114                         52.1 AGCCTTTTTGAACTTTGAAC CAAAACTACCAGCGAACCAG 745/746
56G7-AT (AT)10 02B 4 0.48 1.41 107-123                         49 GTGGCGTGGGTGGTGGATAG AGTGGAATAAAAGCCGAGAG 741/742
X1481559gt (GT)12 02B 2 0.18 0.35 118-144                         51.2 TAAGAGTGTGCCTGTGTGAG CTAAAATGGGTGTAAACCTG 1689/1690
X1721159gt (GT)11 02C 3 0.15 0.36 159-191                         56.9 GAAGTGTCTGCCAGTTGAATG GAGTGCCGACTACTGCCCTAC 2171/2172
X1883543gt (GT)12 02D 5 0.39 0.86 137-149                         52.4 ACGAATACGAAAATCCGAC GGGAGAAGTTGAAGTGGAG 1699/1700
DMC30B8 (TC)21 02F 3 0.35 0.28 140-144                         53 ATAGCATTTGCCAGTGCCAGTA TTGCTCGCTCGCTCGCTCACTC 799/800
X2052732ca (GT)11 02F 3 0.08 1.07 96-122                         51.7 AGAGGGCGAAGAAGAAGAG CCGTTTAACTTTGTGTGC 1681/1682
DMC30B8 (AG)17 02F1-02F6 14 0.79 9.96 130-162 2 0.49 0.99 103-105 1 * * 107 1 * * 105 53 ATAGCATTTGCCAGTGCCAGTA TTGCTCGCTCGCTCGCTCACTC 799 / 800
X2102441ct (CT)15 02f4 20 0.59 12.75 110-160                         55 AAA GAC CTC CTG TCT GGT AC GGA ATG AGT TTG TGC CAC 1770/1771
X2297267gt (GT)9 03A 4 0.60 2.18 134-150                         54.5 AGCATCTGGGAGGCAGCATC TGGTAACTCAACAGACGAGC 2175/2176
DS01001 (GT)9 03A1-A4 18 0.71 10.80 208-241                         53 CCAACGCAACGCAACCAG CTCCCACCCAAAATGGAAATA 258/259
X2307713ca (CA)16 03a7 16 0.74 17.88 162-194                         58 CCC ATA CAG ACA GAC GCA CG ATT GCC ACG CCC ACT TTA TC 1772/1773
P3B02 atc (ATC)8 03b 7 0.09 0.66 73-103                         51 CGA CAG TGA TGC GAG AG AAA GAT GCC GAT GTA AAT G 1296/1297
X2571651gt (GT)13 03B 4 0.37 3.90 101-157                         53.6 CACATCCTGTCTTCTTCTTCTG CGGCATCGTTACACCTCAC 2169/2170
66-95-3 (CA)12 03C 3 0.14 0.63 134-142                         57 GCACAATCACATCGTATTCACTCAGCCAGA ATTGTTGTTGCTGCGATTTTCAAATCAA 260/261
95B7-AT (AT)9 03C 3 0.48 1.20 124-134                         50.6 ACTGGGAACGCTGCTTGATC TGCCAACTGTTTTGCTTGTC 748/749
95B7-TC (TC)10 03C 6 0.52 0.88 117-137                         51.2 GCGAGTAAGAGAGCAAAGAG AAAGCGACAGGGCGGGGTGG 752/753
95B7-TG (TG)8 03C 6 0.52 6.69 144-161                         53.6 GCTTTGTTGCCGTGGGAGTC AAGTTAATTTTCGCCGATGG 750/751
P3B02 gt (GT)6 03C 11 0.00 0.00 123-152                         55 CAG CCT AAA CAC AGA ACA GAA G TGG ACA GAC AGA CAG ACG G 1298/1299
X2609012gt (GT)19 03C 17 0.66 15.75 127-163                         54 TAG TGG ACT CAA AGA CAC ATA C GTC AAG AGG TGT TGT CTG CC 1774/1775
X2986542ta (TA)14 03c 10 0.54 2.37 72-100                         45 GCC AAA TAG ATC ACT AAC TCG CGC TCA AAT AAA CGT ATA TTG 1786/1787
X3026663gt (GT)17 03c 15 0.59 27.51 94-126                         55 AAT GTT TGA CGA CTG CCT CTC GAT GGT CTA AGG GAG CAT CTG 1778/1779
DS06335a (GT)15 03C1-C6 8 0.76 5.57 87-107 3 0.34 0.75 91-99 1 0.00 0.00 97 7 0.89 5.09 93-105 53 ACTGTAATTGCTGTTCTATGT CGCACACTGGGACACAAAA 108 / 62
DS06335b (CA)12 03C1-C6 4 0.34 1.78 136-145 2 0.06 0.03 126-128 1 0.00 0.00 126 4 0.27 2.03 114-130 50 GCACAATCACATCGTATTCACT ATTGTTGTTGCTGCGATTT 1147/1148
AE002566_gtc (GTC)10 03d 10 0.27 6.83 85-112                         58 ATG TCG CCC ATT GCC AC CCG CCA GCA CGA CGA G 1308/1309
X3076173ca (CA)14 03d 9 0.63 17.79 109-125                         55 CAA TGT TCC TGA TGA GCT GTC TGG GTA TTG GGT ATT GCT CG 1790/1791
X3439769ca (CA)15 03d1 13 0.56 36.61 123-150                         55 GCG AGT GAA GAG GGT ACG CAC AAC ATG GCA AAT ACA CGG TCG 1780/1781
AE002566_gt2 (GT)20 03d4 28 0.80 196.78 92-162                         52 TGG TCT TTG CCT CTG TTG ATC TGT TGT GCT TGT GCT G 1312/1313
X3219363gt (GT)18 03d6 26 0.31 6.46 135-170                         55 CAA ATC ATA ATG CCT AAT TCG CAG TTA GAG CCG ATA AGG AGC 1788/1789
X3306698ca (ca)9g(ca)9ta(ca)5 03e2 20 0.60 48.18 116-167                         55 GCA AGT ACC TCA CGA ATT TCC CTC GTG GAA AAC TTT GCC AGC 1794/1795
X3343263ca (CA)13 03e2 13 0.54 15.82 68-108                         58 GCG TAT GAG CAA TGC ACA AAC GGA CCA ACT GCC CAC CTA TAC 1796/1797
X3202250ata (ATA)13 03f 7 0.36 2.13 140-161                         50 GTG CAA ATA GAA AAT AGC TG ACA TTA TTT TGA TGG ACT TG 1792/1793
X3642495gct (GCT)11 03f1 16 0.40 6.32 88-139                         58 AGTGGTTGATTTGAGCACGAG GTTGCCATTACCCAGCATCTG 1782/1783
X3516772ga (GA)14 03f2 12 0.44 4.92 120-142                         55 GCA ACA AAT GGG AGA ATA C AAG TGC CAG ACG GAT TAT AAG 1800/1801
X3525583ta (TA)15 03f2 10 0.35 1.25 64-116                         50 TTG CCC GTC TGT GTG CTT TTC AAT CCA CGT TAA CTT TCA TTG 1798/1799
X3550011ca (CA)16 03f4 14 0.76 73.35 80-116                         52 GTT AAG TAT ATG CCG CTC AAC ACA AAA GCC ACA CTT ACA TGC 1802/1803
X3655941ga (GA)12 03f9 17 0.66 8.34 98-138                         55 CTG AGA ATC GAA TCG GAG TGC GGG AGT TTG TCT TGT AGT AGG 1804/1805
X3821715gt (GT)14 04a3 15 0.79 33.28 100-130                         50 GCA TAG AAA ACC GTG TGC ATG AAT TTT GTG TGT GTG CTA CTC 1810/1811
X3829513gt (GT)19 04a3 16 0.72 80.56 98-134                         58 TGC GAG TAT GTT ACC CAT GAC CTC AAC CCT TTC ACA CAA CAG 1784/1785
DS00036 (CA)10 04A3-A5 4 0.55 1.03 95-101 n.a. n.a. n.a.   n.a. n.a. n.a.   n.a. n.a. n.a.   48 CCCCGCACACACACACACATA TGCTTATTGTTTAATTTACCT 639 / 640
DS00146 (GT)10 04A4-B2 2 0.26 0.13 117-119 3 0.34 0.73 103-111 1 0.00 0.00 109 3 0.39 3.69 99-113 53 GAGTCAACGAGCCAGCAAAGT AACAATACAGAGCAGCACACG 111 / 112
X4071888gt (GT)16 04b 20 0.33 21.52 124-172                         55 CCA CGG CGA AAT CTT ATC AAA C ACC ATC TCA GGG CTG GGG ACC 1816/1817
X3999387ca (CA)15 04b3 19 0.74 23.17 82-116                         56 CCA ACA ACT GGA ACA TAA TTG AGG TGC GAG CAA CTA AAA GTG 1814/1815
X4275758gt (GT)12 04c 11 0.34 5.67 90-112                         55 CCC CCA TCA ATA CAT TTG TAT G ATT TTT GCT GAA AAC TCG TGC G 1818/1819
X4631731ca (CA)13 04c13 10 0.60 3.88 115-135                         55 TTA TGG CAC AAA ATA AAT TCC TTC GAG TCT CTT GCT CTG C 1824/1825
X4364768gt (GT)13 04c8 18 0.56 4.87 128-156                         55 GAT CAC TCA GAT CGG ATG G TCG CTA GTG TGC AAA CAT C 1820/1821
AE002566_ca (CA)25 04c9 40 0.88 200.27 76-175                         53 TTA GCA GAG GCA AGA ACC TAC TCG TTC GGT TGT AGT GG 1314/1315
X4500516ga (GA)13 04d2 10 0.57 4.39 137-157                         58.5 TGG TGC TTC GCA GCT TCT C GGA GCG AGC GAG ACG GCA G 1822/1823
X4814651ct (CT)12 04d3 16 0.59 19.00 96-142                         2-Step:68/94°C GCA AAC GTG TGC CAA GCA GTG ATG CTT AAC GCA GCG GCA GTG 1826/1827
X4944599ca (CA)14 04d7 13 0.48 3.95 97-129                         55 GTC CTG CTG CGT TGA TTA AAC TAG ACA CCC TGA ATG TGA ATG C 1828/1829
X5029944gt (GT)14 04e2 18 0.65 64.53 94-150                         55 ACT GGT GAG TAC TGG TCG AAA G ATG TCT TGA AGC TGG AAA TAA G 1830/1831
X5179712gt (GT)15 04f3 16 0.57 23.17 129-173                         53 GAG TCA CCT AAC GAT TCT TGC ATG TTG CAG GTT CTT ATG ATC 1836/1837
X5326452ct (CT)16 05a2 14 0.80 50.66 122-150                         58 CCT GAT CGT TTC GTC CCA CTG AAT TCT CCC ATC GTT ACA CTC G 1834/1835
X5408669ca (CA)14 05a6 18 0.50 10.24 100-148                         52 CAA CGC TAC ACG AAT TTG TTA C TTA CAA ACA CAT ATA ACA ACC G 1838/1839
X5592060ca (CA)14 05b8 14 0.68 12.84 125-153                         2-Step:68/94°C GAT GAA AGC GAG AGT GGG CAG C ACC ATC GCC CAT TGT CCC ACT G 1840/1841
DS00589 (CA)11 05C1-C2   0.56 8.50 95-95 n.a. n.a. n.a. 78 n.a. n.a. n.a. 80 n.a. n.a. n.a. 78 52 CGTTTTTTATTTGCGGGCAG ACATCCCTCTCTTTCGCTTC 163 / 164
X5710427 (TG)5(AG)3 05c5 4 0.03 1.49 152-166                         53 GTT GAA TTG CGG CGG CCA AGT AAA TGG AGA AAA CCT TCG AGC 49/51
X5973753gt (GT)17 05d3 19 0.50 11.29 126-174                         52 ATC TTC AGC TTG CAG CCT TTG GTG GCA TAA AAT AAA TAA ATG AC 1842/1843
X6213328ca (CA)13 05f6 21 0.51 27.44 78-116                         55 CAC TTA TTT ATT ATT GGC CTG AC GGG TTG CAG CAG CTT AAG GAC AC 1844/1845
X6325133ca (CA)12 06a4 15 0.62 11.19 68-109                         51 GGA TGT TCA AAT GGT TCA AGG CAT TTT CAT AAG ACG CTC AAC 1846/1847
DS06329 (GT)12 06C1-C2 4 0.68 7.63 78-92 n.a. n.a. n.a.   n.a. n.a. n.a.   n.a. n.a. n.a.   54 CCTGGTTGCTCCCGCTGC TTCCGAGATCACCTGAGA 637 / 638
X6694934gt (GT)14 06d7 15 0.45 11.77 112-150                         55 CAT CAT CAT CGT GTG CTC TCC CGA TCT GAT GTG GCC CAC TTC 1848/1849
DS04440 (GT)9 06E1-E2 3 0.54 6.91 112-128 2 0.10 0.05 107-109 n.a. n.a. n.a.   n.a. n.a. n.a.   55 TTCTCCCACCGTAACGCCCTAT ACACAACATCCGTTGCTGCTGT 227 / 228
sex lethal (AT)9 06F4-7B3         n.d. n.d. n.d.   n.d. n.d. n.d.   n.d. n.d. n.d.   44.5 TTTTGTCGTTTTCGTTATG TTTGTATGTTCCTCACTTTA 3 / 2
X7028104ga (GA)16 07a7 14 0.70 7.51 116-142                         55 CTG AAC TCC AGA GAG AAC TGC GAC AAT GCT CCA CAG ATC CTG 1852/1853
X7192669ca (CA)12 07b1 12 0.30 1.53 101-123                         52 TTT GTG AGG CTG TCA TGT GTC TCG TGT AAC ATA AAA TCT TGT GG 1854/1855
X8022709ca (CA)15 07b 15 0.36 6.75 100-146                         52 AAC ACT GGC AAC AAA TAA ACT C ACG TTT TCA AGT CGA GTG TTT G 1864/1865
X7340418ga (GA)12 07b2 9 0.57 3.16 149-167                         55 ATT TCC TGG TAA TAA AAC AGA GAG GCA GCG GCG ATA CGT TAG TC 1856/1857
X7586980ca (CA)14 07c2 11 0.27 9.56 114-134                         55 CTG CAA ACT TGA CGA CAA AAG CGT TTT TAG CCA ATT CCA ATG 1858/1859
81C6 (CT)8 07D 4 0.62 0.97 240-246                         54 GCTGCCCCTCTTCTACTCTC GCCCTCCTTTACTCCACAGAC 39/40
X7809164ca (CA)13 07d3 15 0.40 5.78 94-128                         55 AAA GAA CGT GTT ATT TAT GGT C CGT TAG TTA TTA CTT GGC ATC 1862/1863
X8312980gt (GT)12 07f1 16 0.82 118.62 123-171                         55 GAT GGT GAC GAA GAA GAA GAG C TCA AAA AGT GAT CTC TTG AAG C 1866/1867
X8490060gt (GT)14 08a1 15 0.59 17.17 78-120                         55 GTC TGT GTC CAT TGT TTT GTC G CGC TCG TTC ACT TAC TCA CTT A 1868/1869
DS09021 (GT)12 08B5-B8 8 0.81 36.19 148-180 3 0.57 0.37 140-144 1 0.00 0.00 140 1 0.00 0.00 146 52 TTCCCGCATATGTGTGAG TTTCGTGTACTTCTCGGTGC 105 / 106
X8756567gt (GT)12 08c3 11 0.36 5.48 174-197                         55 TTG TGA AAT GCG GTC ATC TAC ACA GAC AAT GCG AAC AAA GGC 1485/1364
Dm2004-TA (TA)9 08D 6 0.58 1.05 147-166                         47.8 TTGTGTAAGCCGTGTGTATC CCGCTGCGATTGCCCGACTG 758/759
X8956947gt (GT)13 08d1 26 0.69 25.80 88-179                         55 AGC AGG AGT AAA GAA GAG CTT G TTT GCG TTA AGT TTA CGT TAC G 1870/1871
AE002566_atc (ATC)14 08d10 11 0.58 30.95 93-120                         52 TTT ACC AGA TTG CCG TTG GCA GAT TGA TGA TGA GCC 1306/1307
Dm2004-CA (CA)8 08E 4 0.55 7.24 122-128                         52.1 CTTCCCTCTCGTTCGCACTG TTGTGTAAGCCGTGTGTATC 756/757
Dm2004-GA (GA)8 08E 5 0.24 0.13 146-150                         50.6 CGTTTTGGTCGTTCTTGTTC TCGCTCTGTCTCTTGTGTAC 754/755
P08E01gt (GT)12 08e 8 0.23 6.49 100-116                         55 AGGCATATCAAGACGAAT CTCTGGCGGTTCAGGAC 1235/1236
X9312943 (GT)14 08e8 21 0.35 10.74 157-190                         55.4 ACC CCA TTT TTG CTA CGC CTC GCA TTA GGG ATA ACG ATG TGT 872/873
X9317809 (AC)12 08e8 14 0.59 15.80 115-147                         49.7 CAT TTT ATG ATG CCA CCG AAC AGC CGT ATT TCG TAT TTT ATG 880/881
X9325355 (AC)2GC(AC)2TC(AC)6 08e8 11 0.22 2.00 82-100                         52.3 CTG GCT ATT TCG TTC TTG AAG GTG TGC AAG GCT GCG TAT ATG 888/889
X9325868 (GT)14 08e8 18 0.54 41.88 96-127                         52.5 CTA TTT CAT TGA CCG CCT CTG ATT TAG CAT ACG CTT CAC TTC 892/893
DS01391 (GT)10 09A1-A2 4 0.32 4.31 127-141 1 0.00 0.00 125-125 1 0.00 0.00 136 1 0.00 0.00 125 57 GCCTGCTGCAGTCGCATGTG CCAGCGGCATACGTGTAAAC 633 / 634
X9928573gt (GT)13.5 09b3 19 0.34 2.58 132-216                         55 GTT GTG CCT CTG CCA GTC AGT C GAA TTA TTT CAC GAT TAT CTT CAG G 2235/2236
X10509490gt (GA)13 09e3 10 0.53 4.48 65-99                         52 CAA AGC AAT TTT TTG CGT TAG CAA ACA AGC ACA CAA ACT CAC 2241/2242
X10809186ga (GA)13 10a1 7 0.53 3.72 108-140                         58 GGC TAT TTG AGT GGC GAA AG CAG CAG AGC AGA GCC AGC AC 2243/2244
DS00907 (AG)13 10A1-A2 3 0.60 1.15 232-238 n.a. n.a. n.a.   n.a. n.a. n.a.   n.a. n.a. n.a.   56 AGATAGAGCGGCTGGCAACA AGCAGAGCAGAGCCAGCACTT 238 / 292
X11087689ca (CA)14 10b5 12 0.46 4.43 72-94                         55 GCC GCA ATT TGA AGT GCT AC TCT CAT TTT CGC TTT TAT GC 2245/2246
X11347407ca (CA)12 10c3 9 0.09 1.53 122-146                         58 CTG CCT GCT GTT CGT TGT GG CCT ATA ACC ATT ATG CCC ACC CAC 2247/2248
DS01551 (CA)10 10D5-E4 2 0.26 0.13 197-199 3 0.18 0.27 193-197 2 0.07 0.04 193-195 1 0.00 0.00 193 51 CAACAACAAAAACAGCAACGA TGCCAACTGCAAAAACACAGA 145 / 146
X11601257ca (CA)10T(CA)11.5 10f1 20 0.55 10.76 92-146                         55 TTT GTA AAA TTG ATA TCC TGC C TAA CCA TTA AAT TCC AAC TGT GTG 2249/2250
X12075563gt (GT)12.5 11a12 9 0.55 10.89 76-92                         52 ATA TCC TTT TTC TCT CGG TGT G ACG ACT TAG TTG ACT TTT GTG C 2253/2254
X11804446gct (CTG)13 11a4 16 0.56 47.42 81-177                         55 GGT GTA TGG GTA ATG TCC TTG C TGG GGA AAG TGT CAA GTT AAT G 2251/2252
Dmtena (TA)4CC(AT)14 11A6 6 0.70 1.98 91-101 2 0.06 0.50 79-87 2 0.14 0.07 89-91 1 0.00 0.00 87 55 CTCTTAGTGCGCAGGGATTC GAGTCGCTCAATGGCAGG 66 / 67
P11B01ca (CA)9 11b 9 0.56 13.37 119-135                         51 ACATCGCCAGGATTCAC TCCCGTTTACAGCAACAA 1241/1242
P11B01ta (TG)10TA(TG)6 11b 15 0.66 29.77 98-144                         50 AATGATCTGTCGCATATACC TTTATGAAAACAACACATGC 1237/1238
P11B01tg (TG)11 11b 9 0.56 13.34 118-134                         56 GCTTTGCTAATGTCGTGTTGT GTGTCCACTGTGCGGAG 1239/1240
X12358328ca (CA)12 11b13 9 0.51 12.30 108-124                         60 TGG ACT CCA AAA TTC AGG AAT G CCC ACA CAC ATT TTC TAA CAG C 2255/2256
X12683051ct (CT)15 11c1 15 0.68 4.03 176-190                         55 ACA TAG GCT CCA TCT CAT TC AAA GCG ATT TGA AGT TGT GC 1367/1368
X13039889ca (CA)15 11e3 21 0.73 22.94 87-137                         58 GCT TTA CGG GTC GGT CGG TC ACT TGC CTT TCA AAT GGA TGG TG 1486/1487
X13203739gt (GT)20 11f1 21 0.71 100.27 150-214                         55 GTG AGT GGG TGG CAA ATA CTG GAG TTA CAA CCA AAT GAG TAA GAT G 1488/1489
X13623606ga (GA)11 12c1 9 0.08 0.23 131-142                         52 TGA TTG TAT TTG GGT GCG ATT TGG GAA ACA TAT ACC TAC GCA TTT AAC 2263/2264
X13624957 (TG)7 12c1 12 0.06 0.13 112-138                         49 ATA TAT CCT AGG GAT TTG GG TTG GAA AAG CGA AAA GTA AG 194/166
X13631919ag (ga)10.5ta(AG)11 12c1 8 0.39 2.23 130-148                         50 ATT TGT TTA CTT GGA GTG AGT GAG TAA ATA CTC TAC TTG ATT ATC TTC 2265/2266
DS00314 (TG)8 12D1-D2 1 0.00 0.00 163-221 1 0.00 0.00 148-158 1 0.00 0.00 156 1 0.00 0.00 150-158 48 GTGACTGTGTTGATTCCGTG TTGGAAAAGCGAAAAGTAAG 165 / 166
X14128213ca (CA)15 12e4 25 0.79 38.87 154-208                         58 AAC TTT CGC CAC CAG TGT CTG AAT ACC CAG CGG AAC GAG AAC 1494/1495
P12F01ca (CA)16 12f 16 0.69 31.72 85-127                         53 TTGTCGTCACCTGGGAAAG GCCAAAGGGTCATCAGCA 1231/1232
X14425888gt (GT)13 12f1 10 0.49 14.55 126-144                         58 TTT TGG TAT GTG AAT GCG GCT G GAT GGA GGC TAA GTG CGG AAC G 1496/1497
X14765146ct (CT)12 13a8 5 0.14 0.28 132-140                         55 AAC GAT AAT GGA GTG GGT TC ATG TAA TGC GCA AGT TGC TG 1498/1499
X15145611ta (TA)11 13c5 5 0.44 1.09 139-147                         2-Step:68/94°C GGG TCG CCA TTC AAT CGT CTG TTC CGC ATC AGC AAC ATC CCC AAA ATC 2259/2260
X15146508gt (GT)11 13c5 16 0.38 3.07 123-143                         52 TTG TGT GAG TGT AAG TGT GCG T GTA AGT TTA TTC TCT TGC GTT C 1500/1501
X15149564gt (GT)9.5 13c5 9 0.56 9.20 99-137                         55 GCC TAC GTC ACT GTA TCT TCT TTC CGA TAT GTT TAA GCT GCT GAC TGC 2257/2258
X15279912atc (ATC)12 13e1 13 0.65 106.07 92-122                         57 TGC CAG ACG CCA TAA TCA TCA C AGT GCC TTG GTC ATT TGC CTC G 1502/1503
X15544500ata (ATA)10 13f1 11 0.17 1.23 95-109                         50 GGA TCT GAA ACA GAC CGT GG AAC TTA GCA CAC ACG AAC GC 1506/1507
X15556758gt (GT)12 13f1 11 0.61 8.05 89-111                         55 CGT TTC ATT ACA CTC CTT TTC GTC TGC CAT TTT TCA TAA TCT CGT AAG 2261/2262
3641.2 (GGT)5 14A 9 0.74 19.27 101-131                         55 GATTTTCTCGTTCAGCACG CGCTGTTCAAAGAAGCACT 21/22
3451.2 (GGT)5 14A3-A5 9 0.74 19.27 101-131                         55 GATTTTCTCGTTCAGCACG CGCTGTTCAAAGAAGCACT 21/22
X15830711gt (GT)11 14a6 18 0.27 173.98 52-168                         55 TCT CTC ACT TTT GAC ACT CTC C ATT TTA TGT TGT GAA GAG CGA C 1508/1509
X15832452ga (GA)7 14a6 9 0.07 0.07 161-175                         55 TTA TCG AGC GTT GTG GAG CAA G TTG TCT TGA GCA CCA GGG TCT C 2065/2066
X15846674gt (GT)9 14a8 14 0.62 34.12 84-101                         52 ATT GTA TCC CAA AGA GCC CAA C GCT ATG GAC CGT AAA GGT ACA C 2063/2064
X15854539ta (TA)6 14a9 10 0.48 0.49 151-161                         52 GAC TTC CTT CCT GTT TTA TCT G ATT GTA TTG CCT GTG AAA TGA G 2061/2062
X15959225ca (CA)11 14b5 7 0.10 1.57 167-179                         58 GCT GTG TGC TGT TGT TGT TTT C TCC AGT CCA CTC TTC TCT CTG C 1373/1374
X16167081gac (GAC)6 14c6-14c7 3 0.03 0.12 129-134                         58 TTG AGC AGT TGA GCG GCG TCT C TTT ATC GGC ATG TCA TCT CGT C 2055/2056
X16183204ga (GA)7.5 14d1 2 0.29 0.59 109-111                         58 CGA CGG CGA CTT CAT CAT GCT G TTC CAC TTT CCC ATC TCG TTT C 2053/2054
X16197583ta (TA)10 14d1 8 0.49 2.40 152-174                         52 ATT TGG TTT TTC GGA CTT TCT CTA GC GGA CAC ATA CAA GCA TAC ACA AAC AC 2051/2052
X16203512gt (GT)13 14d1 8 0.13 3.57 136-154                         52 GTT CGG TAC TGT TGT CGC TTT ATA TTA GAG GTT ATG TCT CAT TTT G 1375/1376
X16203813gt (GT)9 14d1 4 0.04 2.75 133-166                         55 TGT CTG CCT ATT ACT CTC CTG G CGA AAG CTG CTA GAT GTG AAA G 2059/2060
X16219444gt (GT)7 14d8 3 0.00 0.00 116-166                         55 TAT ACG ATA ACT GCT CTG GGT G TTG CTA TCA AGA AAG GAC CTA C 2057/2058
X16262195ga (GA)9.5 14e1 4 0.63 2.08 117-123                         58 GTT GCG GTC CAG TTA GAT GGG TC TTG AGC CCC AGC CAT CCA ATC 2311/2312
X16349316ga (GA)12.5 14f2 11 0.70 7.37 98-122                         58 TCA CCC ACA AAT GCG AGC GAG AC AAA GTA CGG AAA GAG GGC GAC AG 2307/2308
X16414730ca (CA)12.5 15a1 11 0.67 10.33 140-164                         52 TGG TGT TTC CAC ATT TAT TAA GTA C GCC AAC AGT GCG TAT GAG TGA TAG 2305/2306
X16416576ta (TA)15 15a1 17 0.60 16.00 169-295                         52 ATG AGT GTG ACA TTC TTT CG AGA GGT GGA GGA ACT TGG C 1377/1378
X16416576ta (TA)15 15a1 17 0.60 16.00 169-295                         52 ATG AGT GTG ACA TTC TTT CG AGA GGT GGA GGA ACT TGG C 1377/1378
DS09020 (GT)8(GC)4 15A1-A4 4 0.47 0.75 138-144 4 0.44 0.63 125-131 1 0.00 0.00 127 3 0.43 2.32 125-134 51 CTAAACAGGATGCAGGACAAC GCGATCAAGGTTAAATGGTTC 147 / 148
DS00265a (GA)11 16A1-A6 5 0.72 2.78 119-130 n.a. n.a. n.a.   n.a. n.a. n.a.   n.a. n.a. n.a.   58 AGTGGGTTTCCTCGGCGTGC TTTGCCCACTCAGCTTGCTTCG 229 / 230
DS00265b (AT)5 16A1-A6 7 0.74 9.48 119-130 n.a. n.a. n.a.   n.a. n.a. n.a.   n.a. n.a. n.a.   51 AACAATGCTGGCGACTTCAAG CTCCTCGTTCTCCGTCCCTTAT 231/232
X17276522ct (CT)19 16b1 13 0.65 4.29 111-145                         55 GAT TCT TGT TTA TCC TCC AGC CGT GTC CAG TTC TCA GAC TTG 1381/1382
DS08088 F (TG)12 17A 7 0,43 1,54 127-141                         54 GAGGCGACAGGAAGTTTTAC TTGTGTTTCGTTCCGGTTTC 629/630
X17869774gt (GT)14 17A 13 0.46 9.82 84-117                         58 CTG CGT GAG TGC GTG CGT GC CAC TGT CCC CAT CCA CAT ACC G 1385/1386
X18283112ta (TA)20 17c 15 0.61 76.23 95-133                         50 GCG TTG TGC TGC CCA GTA ATC TCT CTT ATC ACC GAT GTC TTT AG 1389/1390
X18374645ta (TA)16 17c5 14 0.35 24.29 122-150                         50 AGT GGA CGG AAC ACA GAG TAA C AAA TTC AGG GTC GCA CTG GAT G 2073/2074
X18457913gt (GT)10 17d1 9 0.37 25.95 89-106                         55 ACG GTT GAG CTG TCG GTG TTT G TAA CAT GGC TTA TAT GCA ACG C 2071/2072
X18468044ct (CT)9 17d1 14 0.49 2.23 116-150                         58 TTA GTT CAG TGC CCA TCT CAG TCC AAA AGC TGG CAA AAC AGT AAA CAC 2067/2068
X18478793ga (GA)10 17d2 19 0.32 83.40 150-210                         55 ATG CCA TTA AGA GCC TAC CAT C GGC TGC CTC AAG TGT ATT TTA C 2069/2070
X18472039ca (CA)16 17d3 11 0.08 1.09 130-162                         55 ATC AAA TAA CAA CGA CGA GG CGG ACC ACT TGC CAG ATT G 1391/1392
X19942721gt (GT)18 19c4 21 0.73 58.63 117-150                         57 CTG CTG CCA ACT CCA TTC TG TTC TGC CAC ATT TGC GAT TC 1395/1396
X20174995ca (CA) 19E 4 0.50 1.96 50-85                         53.7 CGA CTT ACC TTT GCG TCC AC TAA CAG GAC CCA ACT GCG AC 1397/1398
X20639205ca (CA)27 19e5 20 0.86 37.25 86-124                         55 GGT GAG CAA ATG GGT GGT AG TTC TCC TTG GTC CTT TCT CT 1399/1400
X21100995gt (GT)11 19F 4 0.58 0.93 104-116                         51.7 ACGCCTACTTTCCACCATC TCTGGCAACTCGCACGCAC 1685/1686
X21147800gt (GT)13 19F 3 0.28 1.04 123-143                         46.7 AATCATTAGCTTTCTAGTAAATAC TTTGCATTATCCGACTTACGTTAC 1697/1696
X21297264gt (GT)12 19F 2 0.09 0.24 132-160                         50.8 CTTCCTCATCACCTTCGT CTAGGCAACACCTCACTG 1683/1684
X21300817ta (TA)10 20A 4 0.40 0.74 88-162                         46 AGC TTC TGC TGC TGG CTT TAT CTA AGT CTG TTT TAT ACT AAA TAC AAG 2165/2166
X21408452ta (TA)9 20A 3 0.32 0.68 105-125                         47 TTCGTTTGCTACAATCACCGCTC AATATAGGATAGATATCCCATTCC 1679/1680

Letzte Aktualisierung 26.09.2002