Microsatellite loci isolated from D. virilis

 

 
Locus
Cytological

Postion

Repeat type in clone
(D. virilis )
Annealing temp.

(in °C)

Primer sequence

(5-3 orientation)

D. virilis

V                H

D. lummei

V                H

D. a. texana

V                H

D. a. americana neo Y

V                H

D. a. americananeo X

V                H

V68-74
41D
(TG)10
56
gacgatttgcggttcaactt
1.640
0.699
13.103
0.781
53.367
0.611
7.211
0.780
1.554
0.656
        cgccatgttgtgtctttgtt                    
V71-38
42E3
(TG)8A(GT)3GCA(TG)17
56
aaatgccagcgacacgttac
15.809
0.657
n.a.
n.a.
*
*
*
*
*
*
        gtcctcacgacttttggcat                    
V68-4
43A1
(CA)5CC(CA)14
50
aagacgggctgaggatgtgag
35.508
0.817
17.590
0.639
11.067
0.833
6.544
0.620
3.643
0.656
        aacaataaatgatgtgaaatc                    
V68-48
43E
(GT)8(GTT)3(GT)7
56
gccagtattatgtgtgcgtga
1.280
0.533
n.d.
n.d.
n.a.
n.a.
n.a.
n.a.
n.a.
n.a.
        tgtgttggcataaatgcttca                    
V68-62
44E
(GTT)8
56
atgttgcaagctgttgttgc
0.757
0.664
7.286
0.592
1.54
0.778
1.822
0.340
4.696
0.531
        tcggtgtcattcgtaggttg                    
V71-6
47B1-2
(GT)15
53
cgaacagtttagccagaa
24.434
0.844
73.859
0.710
3.367
0.722
18.900
0.800
13.643
0.750
        acagataaacagttgcacag                    
GPDH
47B
(CA)9A(AC)3 *
56
cgcttggcgtttttattgat
18.138
0.773
2.629
0.653
7.642
0.833
13.692
0.840
4.531
0.750
        accagatcaggtacggcaac                    
V71-3
47C
(TG)7
52
aaagcaatacaagtttgtgt
3.500
0.588
6.291
0.694
*
*
*
*
*
*
        cgatgccgttatttagc                    
V68-86.1
48A
(TG)4TA(TG)5TA(TG)10
56
tcgcatctcaaaatttaattgac
26.882
0.754
41.423
0.497
0.667
0.278
9.600
0.340
19.411
0.562
        agcagcaaaacgaagcaaat                    
V68-86.2
48A
(CA)5GAG(AC)4G(CA)3
56
tccatttcattgatgcgtgt
18.000
0.727
8.256
0.272
2.667
0.278
7.111
0.560
12.572
0.562
        agaaatgaagagcagaggcg                    
V93-93
49A2
(TG)4CGG(GT)7GCAA(GT)11G(GT)4
56
cagaaacccaactgtcagca
10.559
0.692
20.144
0.805
17.067
0.778
7.656
0.640
12.268
0.531
        tttgattgatgaatgcatatgag                    
average
       
14.228
0.704
21.176
0.627
12.173
0.511
9.067
0.615
9.040
0.625

* in D. a. americana
 

These loci have been published in Schlötterer (2000)