D. melanogaster       D.simulans       D.sechellia       D. mauritiana          
Locus Repeat cyt. location No. alleles Het. Varianz size range No. alleles Het. Varianz size range No. alleles Het. Varianz size range No. alleles Het. Varianz size range Annealing temp. Primer forward reverse
DMC30B8 (AG)17 2F1-2F6 14 0,789 9,96 130-162 2 0,492 0,992 103-105 1 * * 107 1 * * 105 54,2°C atagcatttgccagtgccagta ttgctcgctcgctcgctcactc
DS06335a (GT)15 3C1-C6 8 0,765 5,572 87-107 3 0,342 0,754 91-99 1 0 0 97 7 0,886 5,088 93-105 53 actgtaattgctgttctatgt cgcacactgggacacaaaa
DS06335b (CA)12 3C1-C6 4 0,338 1,781 136-145 2 0,063 0,031 126-128 1 0 0 126 4 0,272 2,029 114-130 50 gcacaatcacatcgtattcact attgttgttgctgcgattt
DS00036 (CA)10 4A3-A5 4 0,546 1,027 95-101 n.a. n.a. n.a.   n.a. n.a. n.a.   n.a. n.a. n.a.   48 ccccgcacacacacacacata tgcttattgtttaatttacct
DS00146 (GT)10 4A4-B2 2 0,259 0,130 117-119 3 0,340 0,729 103-111 1 0 0 109 3 0,394 3,691 99-113 53 gagtcaacgagccagcaaagt aacaatacagagcagcacacg
DS00589 (CA)11 5C1-C2   0,560 8,500 95-95 n.a. n.a. n.a. 78 n.a. n.a. n.a. 80 n.a. n.a. n.a. 78 52 cgttttttatttgcgggcag acatccctctctttcgcttc
DS06329 (GT)12 6C1-C2 4 0,683 7,630 78-92 n.a. n.a. n.a.   n.a. n.a. n.a.   n.a. n.a. n.a.   54 cctggttgctcccgctgc ttccgagatcacctgaga
DS04440 (GT)9 6E1-E2 3 0,541 6,911 112-128 2 0,096 0,048 107-109 n.a. n.a. n.a.   n.a. n.a. n.a.   55 ttctcccaccgtaacgccctat acacaacatccgttgctgctgt
sex lethal (AT)9 6F4-7B3         n.d. n.d. n.d.   n.d. n.d. n.d.   n.d. n.d. n.d.   44,5 ttttgtcgttttcgttatg tttgtatgttcctcacttta
DS09021 (GT)12 8B5-B8 8 0,808 36,186 148-180 3 0,573 0,371 140-144 1 0 0 140 1 0,000 0,000 146 52 ttcccgcatatgtgtgag tttcgtgtacttctcggtgc
DS01391 (GT)10 9A1-A2 4 0,319 4,308 127-141 1 0,000 0,000 125-125 1 0 0 136 1 0,000 0,000 125 57 gcctgctgcagtcgcatgtg ccagcggcatacgtgtaaac
DS00907 (AG)13 10A1-A2 3 0,595 1,155 232-238 n.a. n.a. n.a.   n.a. n.a. n.a.   n.a. n.a. n.a.   56 agatagagcggctggcaaca agcagagcagagccagcactt
DS01551 (CA)10 10D5-E4 2 0,259 0,130 197-199 3 0,180 0,265 193-197 2 0,071556 0,03575 193-195 1 0,000 0,000 193 51 caacaacaaaaacagcaacga tgccaactgcaaaaacacaga
Dmtena (TA)4CC(AT)14 11A6 6 0,697 1,981 91-101 2 0,063 0,500 79-87 2 0,137926 0,06875 89-91 1 0,000 0,000 87 55 ctcttagtgcgcagggattc gagtcgctcaatggcagg
DS00314 (TG)8 12D1-D2 1 0,000 0,000 163-221 1 0,000 0,000 148-158 1 0 0 156 1 0,000 0,000 150-158 48 gtgactgtgttgattccgtg ttggaaaagcgaaaagtaag
DS09020 (GT)8(GC)4 15A1-A4 4 0,473 0,752 138-144 4 0,444 0,627 125-131 1 0 0 127 3 0,433 2,317 125-134 51 ctaaacaggatgcaggacaac gcgatcaaggttaaatggttc
DS00265a (GA)11 16A1-A6         n.a. n.a. n.a.   n.a. n.a. n.a.   n.a. n.a. n.a.   58 agtgggtttcctcggcgtgc tttgcccactcagcttgcttcg
Cd36 (GA)17 21B7-21C3 1 0,000 0,000 156 2 0,226 0,113 158-160 1 0 0 162 1 0,000 0,000 158 49,5 tgtctaatcttacctaaatac atttatgctttaagctaagtc
Eno2 (TA)20 22A1-B2 17 0,856 26,19 111-147                         55,2°C gctggtgcgtttccaagaag aagatgctgtgagaaataag
Eno-TA (TA)9 22A2-A5 12 0,730 5,036 146-169                         51,3°C tgcattctggcgacgctgac aaatctcccacaaatgtcac
Eno-TC (TC)9 22A2-A5 6 0,196 3,300 123-136                         46,8 °C tcataattccatgttccacac taaatagtcacttagcttgaaag
Eno-CA (CA)9 22A2-A5 6 0,618 12,735 168-180                         51,3 °C taaaattgcacaacataacttg tccgtgtgcgtatgttcctgtg
Z50409 (GT)7 22B1-B9 3 0,670 7,389 126-138 3 0,394 0,944 125-133 1 0 0 129 4 0,590 0,432 125-129 50 gcaaaacggaaaagcaaaaga gtgtgttccacttccttctac
AC005749 (GT)4GG(GT)17 22B3-22C1 16 0,83 20,42 129-171 3 0,647 2,39 138-142 1 * * 140 2 * * 138-142 56°C tacaaaaccgacgcataaaatac tagatacctagttcggctaag
Droyanetsb (TG)21 22C 15 0,740 16,695 84-122 3 0,506 0,286 80-84 2 0,261692 0,131 86-88 2 0,173 0,087 82-84 55 taatggggaatgggtgaatg gccgtgctcttttctcttacg
Pkg-TA (TA)8 23A1-A3 10 0,555 3,379 111-122                         48,3°C aatcaaagcaacaacaacagtg tgcgtagccgtgccatactc
Pkg-TC (TC)9 23A1-A3 7 0,731 7,388 104-118                         50,5 °C gaaaagcggaaaagccacac ttattttgttgccttctctg
Pkg-GT (GT)9 23A1-A3 11 0,615 45,499 139-177                         53 °C cctcgtattcaccccatctc tggagacgacgacgaacttg
DS01340 (AG)9T(GA)3 24A1-A2 7 0,653 1,648 176-190 3 0,686 0,618 159-163 1 0 0 165 5 0,735 1,780 172-182 55 ggagcgcaatgctgtttaagt ggagtagtgcctgtctcggac
Dm0600-TA (TA)11 24C3-D1 10 0,610 3,980 153-175                         50,6°C ggaagaaagagagggagaatc tgtgggaaatgaaaacgaaag
Dm0600-TC (TC)9 24C3-D1 10 0,434 12,307 112-132                         50 °C accgtcaacaaaaagcatac gaaagtcaaaagccgcacac
Dm0600-CA (CA)9 24C3-D1 9 0,634 10,350 146-170                         50,8 °C tgcctccgaacctctgagac cctgcctctgtatctgtatc
ft-TA (TA)7 24E1-E4 5 0,097 25,676 132-196                         53,0°C acaggctaagcggcaacaac gcgggtgctacgtgtgactc
ft-TC (TC)9 24E1-E4 16 0,699 25,747 154-178                         51,9 °C ctttgtcccctcattttctc aatggttggatgtggatgtg
ft-CA (CA)9 24E1-E4 5 0,461 18,896 130-144                         54,9 °C gtgggttgaaggggaagaag cgcagtggaacagccagttg
AC005270 (AC)19 24E1-F1 13 0,816 11,22 125-149 6 0,089 2,005 119-130 1 * * 125 2 * * 123-125 45,6°C cggcagacgacacttgacac gagaccagccgccttgacta
Drogpdha (CT)7 25F5-26 A 3 0,472 0,076 132-134 3 0,522 0,185 129-132 1 0 0 130 1 0,000 0,000 130 53 cattggaaaagtgagcggat cggacaacaacaaatcgttg
DS00168 (GT)9 26A1-A2 1 0,000 0,000 112 3 0,570 0,388 117-121 1 0 0 117 n.a. n.a. n.a.   57 ccgcttcctgtccgcttgc ggcgggaagagcatttgtt
Acp26Ab (CA)13 26B3-B5 5 0,650 1,296 160-168 4 0,621 1,839 141-150 1 0 0 148 1 0,000 0,000 142 50 cacaaaggactcggcaagcac atcctccaaatgaaattacag
Dm2337.2 (TA)23 26F1-27C2 14 0,755 22,96 162-198                         48,3°C cgtagctgaattttcatgtc cgaaatcagaggtcacttac
Dm2337.2 (TA)23 26F1-27C3         3 0,254 0,735 128-134 4 * * 152-162 3 * * 130-136 50°C tcgaacgagaccgtagctgaat gccgcactcaaaactgccactg
Dm2337 (CA)15 27A1-B1 6 0,795 2,335 150-160 4 0,545 0,767 139-148 1 0 0 134 3 0,498 0,314 144-148 57 ccatttttccgccccaatgtc acggtgggaaagcgtggaaag
Droninac (AT)10 28A1-A3 3 0,446 0,259 136-140 3 0,417 1,222 133-140 n.a. n.a. n.a. 133 n.a. n.a. n.a. 130-140 56 tttgtcaatctctcacagcagg gcccgagtacatttattcaagc
su.var (TG)12 29A5-B4 6 0,682 4,177 164-176 6 0,655 13,602 133-189 1 0 0 172 2 0,515 0,257 162-164 56 ggttgctgggagaaagac gccacacattcgcatctc
DS08088 (TG)12 29C1-C4 7 0,426 1,542 127-141 4 0,367 0,993 134-142 1 0 0 136 n.a. n.a. n.a.   54 gaggcgacaggaagttttac ttgtgtttcgttccggtttc
DS01054 (GT)7 30A1-A2 1 0,000 0,000 180 5 0,505 1,418 164-174 2 0,071556 0,009 163-164 n.a. n.a. n.a. 152-174 57 tcctgctcctcgggctttac aaaacagccacttcacacac
DS03018 (AC)8 30A3-A6 4 0,516 0,932 95-101 3 0,542 0,406 97-101 1 0 0 97 4 0,515 1,266 91-101 52 cgttcatgaccttgaaaagc gtgtgaaatgtaggggaaac
DS00058/2 (TG)13 31A1-A2 4 0,553 3,948 123-131 1 0,000 0,000 115 1 0 0 115 n.a. n.a. n.a.   57 tatgggtgggtagctgtgac caacgggaacgccatctaac
DS04172 (CA)8G(CA)6 32A3-D4 13 0,914 10,030 75-101 3 0,282 0,042 74-76 1 0 0 75 2 0,298 0,039 74-75 55 gaacggaaatcattcttctg cactacccagcactgcaagg
G410 (TC)11(TG)4 33E9-E10 12 0,740 14,070 124-162 5 0,563 0,678 122-128 2 0,086773 0,39125 126-132 3 0,450 1,039 124-132 53 ttcggctctttgtttgcttg aagcttaaaccgatcgaaaac
L49403 (TA)19 35B2-B10 19 0,846 58,38 139-235                         54°C aacttgaggggttgattc gaagcgaagggggttttattc
AC004118 (TC)18 35B2-B3 16 0,782 7,28 109-141 1 0 0 96 1 * * 96 1 * * 96 53°C gcacacggcgttcgcactct cgagttcacttgacttgtct
Adh-TA (TA)9 35B2-B4 6 0,583 1,989 163-173                         51,7°C gcaactcaataaacccaatttc caaaaagccacaaatcgcagtc
Adh-TC (TC)11 35B2-B4 9 0,685 22,630 132-158                         54,6 °C cagcaccagcatccaagtac agtctctgtggcagtgtgag
Adh-TG (TG)11 35B2-B4 4 0,151 0,354 144-152                         51,2 °C ttgaaagtgttgtcgctctg acaaagaggaagagggcatc
6744 (CT)8 35E6-F5 3 0,263 0,139 90-94 3 0,404 0,226 90-94 2 0,137926 0,06875 92-94 2 0,247 0,124 92-94 56 cgctaagagtcgctctccat aaattgtttgcccgtctcac
cact-TA (TA)9 35F1-F6 10 0,587 8,850 146-178                         48,2°C gcacgaaaacggaataacatag ggcaaaagaaaacaacggactg
cact-TC (TC)9 35F1-F6 5 0,154 0,467 110-118                         54,2 °C aaccagacgtagcgaaaaac aagagagggagcacaacatc
cact-TG (TG)9 35F1-F6 5 0,541 1,278 148-155                         53,1 °C ctatgaaacgatgggcaaag tgacattaaaagggcaaaac
L49408 (TA)25 35F5-F12 24 0,892 15,99 101-157 7 0,826 28,247 100-116 1 * * 104 2 * * 102-104 51°C tcagagacatatccaaacacc acacacatttccattcctcag
DS00762 (GT)6T(TG)7 37B1-B2 3 0,532 1,910 114-129 4 0,523 0,665 114-120 1 0 0 117 7 0,831 10,970 112-134 52 gacagttgcaggcgcaccaac gtagcgtgtgcatttgacact
DS09065/1 (GT)14 38A1-A2   0,700 5,570   n.a. n.a. n.a.   n.a. n.a. n.a.   n.a. n.a. n.a.   55 ggtttcattccagcagaggg ccttcatttggcagcgtca
Dm0332-TA (TA)9 38B5-C2 7 0,649 1,049 130-137                         49,0°C caacttcccgaacaccaattac cagcagttcattaaaccgacac
Dm0332-TC (TC)8 38B5-C2 4 0,364 0,943 107-113                         54,6 °C tatcctgccaccactgaatc aactgtttgcgttgcgtgtg
Dm0332-CA (CA)9 38B5-C2 7 0,383 32,601 118-146                         54,3 °C gtgtggacgtgcggcttttg ggctctgtggaaaactcaac
Cad-TA (TA)9 38D4-E1 8 0,716 11,678 153-169                         49,8°C caactcatccccgaaataag acgaaaccgtgaaaagattg
Cad-GA (GA)11 38D4-E1 7 0,466 4,641 138-152                         55,7 °C aggcactctctgggcgaaac cgtcactaggtcggggtatc
Cad-CA (CA)11 38D4-E1 10 0,745 9,744 130-154                         52,8 °C gaaccccaagccgaggattg cacagccagaccagatgtag
DS07289 (TG)8 41E3-E6 2 0,481 0,241 130-132 1 0,000 0,000 122 1 0 0 122 1 0,000 0,000 122 54 ctcgttctgacgtccgtatc cttctctaatggcaaacacg
tor-TA (TA)9 43B3-C5 6 0,266 1,607 149-161                         48,6°C atatgttcgcctggctacac atttctcttgtttggctatg
tor-TC (TC)8 43B3-C5 2 0,374 0,751 109-111                         56,2 °C aacgggagcaagagtgtaag ctttttcgccgccccagcag
tor-GT (GT)11 43B3-C5 7 0,533 8,209 146-160                         51,5 °C ccttgacatggcacagagtc tgatggaatgacaggctaag
tor (CA)13 43B3-C5 5 0,741 1,486 102-112 4 0,392 0,473 102-110 2 0,071556 0,03575 108-110 2 0,173 0,087 104-106 54 tgcagtcatcaatggctaatc tgatttcccccgtccgaagtg
5915 (CT)21 44D5-E4 6 0,462 6,085 114-130 4 0,754 1,323 104-110 1 0 0 104 4 0,576 3,093 104-118 54 atgcccctgactctctccac gagccggttgcatgtaag
Drogpad (GT)9 47A 5 0,523 1,988 158-191 6 0,525 1,140 157-165 1 0 0 148 2 0,173 0,346 152-156 56 gaaataggaatcattttgaatggc aattaaaaacaaaaaacctgagcg
Dmmp20 (CA)10 49F9-F13 4 0,571 0,224 86-93 4 0,621 7,878 71-88 2 0,137926 2,47625 76-88 3 0,706 1,830 76-84 55 catgcaaatgagcagtactttg tattttcacacatttccaatcg
Dm0620 (GT)9 51E5-E8 4 0,532 0,792 133-143 4 0,730 1,319 139-145 1 0 0 139 3 0,571 0,657 139-143 55 gagacaccccttgacgagtg ctcaaaacaaacccagtctc
DS00541 (CA)10 52C1-C2 4 0,324 0,600 138-148 8 0,763 21,099 132-158 2 0,205333 1,641 130-138 4 0,489 0,408 142-148 57 gcacgaggtatcgcacaaag tccgtcgttcgctgctgggt
Sca1.b (GT)18 52D1-D15 9 0,726 2,65 147-167 3 0,262 1,247 142-146 1 * * 146 2 * * 142-146 51°C aattcattccgtttttcaagtg accaaggtgtgggtgaagttgt
AC00556 (TA)20 52D1-D15 17 0,809 6,47 150-188                         48°C gagtaaaaagacgctcagt tctactaccacccgataac
Sca 1 (CA)18 52D1-D15 17 0,776 10,42 90-126 4 0,534 3,029 104-114 1 * * 112 1 * * 112 46,4°C cttgctccacgcacttacac gcttgctgattttcgcatta
AC004248 (CA)22 52D2-D15 12 0,368 38,04 98-140                         53°C aatttccctcgcactgacac tgcagcccgcacttccttac
sli (CA)21 52D9-D15 2 0,126 0,063 134-136 4 0,478 4,749 134-144 4 0,668889 4,37425 150-160 5 0,779 2,684 144-154 57,5 caatttccctcgcactgacac cggaaacgaacgggcgataag
Pkc53E-TA (TA)8 53D1-D5 5 0,103 2,185 124-137                         51,0°C gtaacaacccatcccaagtg tcctcatggctcccgattac
Pkc53E-GA (GA)11 53D1-D5 12 0,504 8,078 117-149                         50,9 °C cagagaacagagcgagtgac ccgtaagcaccttccatgtc
Pkc53E-CA (CA)11 53D1-D5 15 0,737 251,792 120-144                         51,7 °C taatcaagtgcaatccaacaa tgcaaaacggaaccaggcagac
AC004641 (CA)22 53D1-E2 25 0,91 26,01 92-154 3 0,443 11,926 96-108 1 * * 106 3 * * 98-108 55°C atcacaactggaccctctat aatttcacaaccaacaacta
DS00361 (CA)8 54B1-B2 6 0,373 6,634 132-155 7 0,814 6,961 143-159 1 0 0 151 6 0,792 1,814 143-154 52 caaccacccacaagcacac cctctccggttgggctac
DS00361c (TG)7 54B1-B2 4 0,334 0,551 120-128 3 0,488 0,310 122-126 1 0 0 124 4 0,641 0,658 122-127 51 cgttaagcgtcgaaaatag ctttagcactttgcattcc
DS00144 (CT)8 55A1-B1 3 0,098 0,024 115-117 3 0,658 0,561 115-119 3 0,330231 0,79475 113-121 3 0,542 0,323 115-119 52 gctcagacccaaatggcgtag aaactcaaactctccagcgag
Ote-TA (TA)8 55A2-B1 4 0,227 0,787 141-147                         48,3°C aaaggactacagcagcactc agacagcggctcagggtaag
Ote-GA (GA)11 55A2-B1 7 0,529 4,662 106-118                         55,4 °C gttgattgcttgacaaattgcc ctgccccctgtcgccatttctc
Ote-CA (CA)12 55A2-B1 13 0,739 24,168 162-198                         49,7 °C gcagtcgcaacgtagggagaag agtatgctacacgaatttgaag
Dpt-TA (TA)8 55F1-F6 15 0,804 12,474 150-171                         49,7°C agaaaagcggcaaccaagtc tctcacttccccctctttac
Dpt-TC (TC)9 55F1-F6 4 0,039 0,159 174-180                         53,9 °C gcaactcttgcgtttttatc gaccacctcgctccctcttg
Dpt-GT (GT)9 55F1-F6 8 0,562 4,976 126-139                         50,6 °C gcaaaccgttttccatttac cataactaactggggacttg
DS08687a (TG)11 57C5-D1 5 0,377 0,516 180-186 7 0,722 7,185 168-186 3 0,40625 3,54 176-188 4 0,714 2,684 176-186 54 tgatttggactgagatcagg gcccaacgaatcatttcac
DS08687b (GT)9GC(GT)3 57C5-D1 10 0,789 2,751 156-173 3 0,422 1,763 134-145 3 0,170409 0,2095 135-139 6 0,834 10,937 114-143 52 tgtcgagagcagcagcagt ttgccttccctgttacag
AC002446 (TC)18 58B1-B2 14 0,708 9,40 144-188 5 0,743 5,764 136-144 3 * * 146-150 2 * * 138-142 57,6°C tccttattcggtctacaaatct atacacatgcacatccgtatag
Dm1639-TA (TA)9 58B10-C4 8 0,651 4,980 153-175                         50,3°C aaacaaaagcctgtcaagtgtg tgtagtcaaggaggtttgagtg
Dm1639-TC (TC)12 58B10-C4 8 0,657 5,875 102-120                         55,2 °C gcctcgctccgtcccgttcc cgattgtttccattgttcac
Dm1639-CA (CA)11 58B10-C4 13 0,582 39,005 139-177                         52,9 °C cattggtttcttccgttttc cgtgccaggttgccttttag
Z32225 (GT)10 58C1-C7 4 0,160 5,667   n.d. n.d. n.d.   n.d. n.d. n.d.   n.d. n.d. n.d.   52 atggcaaccactgctgacac gcatcctggaagtcctttag
Z31849 (GT)10 58C1-C7 3 0,484 2,321 137-147 n.a. n.a. n.a.   1 0 0 134 2 0,189 0,095 131-133 53 cccattaaggccgataagtc gagatagctctgtttgccag
G411 (CT)6(TG)4 58C2-C5 3 0,402 0,231 158-162 6 0,774 3,099 156-168 2 0,237318 0,26675 160-163 4 0,784 0,557 160-164 50,5 attgctgtttggagtttgttg ggtcgcagggacacaattcac
DS08011 (GT)8 59A1-B2 7 0,778 6,593 102-122 5 0,621 6,183 100-112 1 0 0 104 1 0,000 0,000 102 53 agccacagccatgcgtttaac cacacgctgacaggatctact
Dromhc (CA)13 60 E9 5 0,725 0,605 101-106 6 0,722 3,016 89-101 1 0 0 91 4 0,723 2,158 91-99 57 aaacccacacaacaactgca gacattaccgatattggatgca
Antp-TA (TA)8 84A2-B2 4 0,465 1,055 160-167                         46,4°C agccgcaaatacttccaaac caagatttcgtcgttcatac
Antp-TC (TC)9 84A2-B2 5 0,248 1,622 146-163                         50,0 °C gctttcgatcccatagatac cgggctcatctaatgatatg
Antp-GT (GT)8 84A2-B2 3 0,032 0,065 135-139                         57,3 °C cccgccccttccctgctaac atatgtgtctgcgtcgtgtg
Antp 1 (GT)26 84B2-C2 29 0,925 51,07 122-208                         51,4°C cgttcgttcatgggcttttc ctctttaatatcggggttgg
Antp 1 (GT)26 84B2-C3         7 0,688 14,21 101-113 1 * * 101 1 * * 101 53°C taatatcggggttgggggtg gttcgttcatgggcttttct
DMTRXIII (CT)23 88B3 37 0,948 23,77 92-150 5 0,646 5,987 100-110 1 * * 102 1 * * 102 54,6°C aggtgtgtgcgtttgctctc gccgaacgaacacgaagata
M18 (GT)27 unmapped 33 0,954 53,48 152-234 5 0,767 17,655 148-160 1 * * 156 3 * * 134-158 57,8°C cccgtcaccaaagtgaaaac tcaggaatgttagcaagcga
M12 (GT)25 unmapped 35 0,944 88,83 166-288                         45,5°C tccgtctcctttgtggctat cagtgcaaagaaaacggtga
DM73.alt   unmapped 32 0,952 52,56 88-166                         47,3°C accaaagtgaaaacacaacaag acgctgctcccctcacacacac
DMC11F6 (TA)20 X-chr         1 0 0 120 1 * * 122 2 * * 132-152 50°C tcatggagcttccttcatatac tggcaagagtccgttggggctg
DMC11F6 (TA)20 X-chr 12 0,269 11,56 199-227                         50°C acttttagagggcggatg gactgaactgggggtatc
sec 1 (AG)10   6 0,697 2,588 196-212 4 0,766 1,280 200-206 2 0,071556 0,03575 202-204 2 0,455 0,227 198-200 53°C cggagagtggagattcgagag ggcccatgcgttcgtgtgtcg
sec 3 (GT)9   1 0,000 0,000 148 7 0,814 17,894 146-174 1 0 0 151 6 0,853 5,489 146-160 55°C gtttccccaacgctgcgtgtg agtccaacttttgcctcagtc
sec 6 (AG)20   4 0,558 0,415 132-138 5 0,692 4,511 122-143 8 0,831808 9,8575 138-166 2 0,091 0,046 124-126 50°C taaaataagggatcaaaagtc gcgcgtataatcacatatttc
sec 7 (GT)9   9 0,739 34,898 159-191 5 0,757 4,265 145-155 1 0 0 149 4 0,636 2,760 143-155 50°C ggtatggtcgaaagaaatatc taactgtggctattttggtgac
sec 9 (GT)9   1 0,000 0,000 142 2 0,280 0,035 138-139 2 0,071556 0,14275 137-141 2 0,257 0,032 138-139 48°C ttaataacattccaggagttg caaacaccaaaaaaccgtgta
sec 12 (GT)10   4 0,545 0,740 108-120 6 0,785 2,789 106-120 4 0,267556 1,382 106-115 3 0,692 0,762 108-112 55,5°C aaatcagcagggctgccaaac cgcacgcatacaaaagcatac
sec 13 (GT)7GG(GT)3   8 0,629 11,580 136-173 3 0,234 0,319 136-142 2 0,515407 0,258 134-136 4 0,398 1,041 128-140 51°C aatacatttaccatttgttag tacacagacacacaggattac