D. sechellia microsatellites (not mapped)

        D. melanogaster       D.simulans       D.sechellia       D. mauritiana            
Locus Repeat cyt. location No. alleles Het. Variance Size range No. alleles Het. Variance size range No. alleles Het. Variance Size range No. alleles Het. Variance Size range Annealing temp. Primer forward reverse internal reference
sec 1 (AG)10   6 0.70 2.59 196-212 4 0.77 1.28 200-206 2 0.07 0.04 202-204 2 0.45 0.23 198-200 53 cggagagtggagattcgagag ggcccatgcgttcgtgtgtcg 294 / 295
sec 3 (GT)9   1 0.00 0.00 148 7 0.81 17.89 146-174 1 0.00 0.00 151 6 0.85 5.49 146-160 55 gtttccccaacgctgcgtgtg agtccaacttttgcctcagtc 298 / 299
sec 6 (AG)20   4 0.56 0.42 132-138 5 0.69 4.51 122-143 8 0.83 9.86 138-166 2 0.09 0.05 124-126 50 taaaataagggatcaaaagtc gcgcgtataatcacatatttc 300 / 301
sec 7 (GT)9   9 0.74 34.90 159-191 5 0.76 4.26 145-155 1 0.00 0.00 149 4 0.64 2.76 143-155 50 ggtatggtcgaaagaaatatc taactgtggctattttggtgac 302 / 303
sec 9 (GT)9   1 0.00 0.00 142 2 0.28 0.04 138-139 2 0.07 0.14 137-141 2 0.26 0.03 138-139 48 ttaataacattccaggagttg caaacaccaaaaaaccgtgta 356 / 357
sec 12 (GT)10   4 0.55 0.74 108-120 6 0.78 2.79 106-120 4 0.27 1.38 106-115 3 0.69 0.76 108-112 55.5 aaatcagcagggctgccaaac cgcacgcatacaaaagcatac 358 / 359
sec 13 (GT)7GG(GT)3   8 0.63 11.58 136-173 3 0.23 0.32 136-142 2 0.52 0.26 134-136 4 0.40 1.04 128-140 51 aatacatttaccatttgttag tacacagacacacaggattac 360 / 361

Last Updated on 14.07.1999