D. melanogaster microsatellites not mapped

        D. melanogaster       D.simulans       D.sechellia       D. mauritiana            
Locus Repeat cyt. location No. alleles Het. Variance Size range No. alleles Het. Variance Size range No. alleles Het. Variance Size range No. alleles Het. Variance Size range Annealing temp. Primer forward reverse internal reference
M18 (GT)27 unmapped 33 0.95 53.48 152-234 5 0.77 17.66 148-160 1 * * 156 3 * * 134-158 55.2 cccgtcaccaaagtgaaaac tcaggaatgttagcaagcga  
M12 (GT)25 unmapped 35 0.94 88.83 166-288                         56 tccgtctcctttgtggctat cagtgcaaagaaaacggtga  
DM73.alt   unmapped 32 0.95 52.56 88-166                         54 accaaagtgaaaacacaacaag acgctgctcccctcacacacac  
DMC11F6 (TA)20 X-chr         1 0.00 0.00 120 1 * * 122 2 * * 132-152 50 acttttagagggcggatg gactgaactgggggtatc  

Last Updated on 14.07.1999